FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623508_at:

>probe:Drosophila_2:1623508_at:728:265; Interrogation_Position=1090; Antisense; CTAAACACACACGAGGTCCTGGGTA
>probe:Drosophila_2:1623508_at:327:483; Interrogation_Position=1112; Antisense; GTATATACCATTGCACCTTCGGATT
>probe:Drosophila_2:1623508_at:289:225; Interrogation_Position=1138; Antisense; AAGGAGTTCACATTCGATGCGAAGA
>probe:Drosophila_2:1623508_at:690:527; Interrogation_Position=1167; Antisense; GGGAGAAAACCGTACCACAGCACTT
>probe:Drosophila_2:1623508_at:396:561; Interrogation_Position=1203; Antisense; GGAACTAAACACGTATCTCATGTCT
>probe:Drosophila_2:1623508_at:182:235; Interrogation_Position=671; Antisense; AATCCCTGAAGCTGGGTATCTTCGA
>probe:Drosophila_2:1623508_at:178:461; Interrogation_Position=705; Antisense; GATTTCGAACACAGAACTGCCCTGG
>probe:Drosophila_2:1623508_at:187:13; Interrogation_Position=736; Antisense; ATTAGAAACCTAGAGCAGCTGCAGT
>probe:Drosophila_2:1623508_at:432:441; Interrogation_Position=777; Antisense; GATGGTGTGGTTCCTATCGAAACTG
>probe:Drosophila_2:1623508_at:233:391; Interrogation_Position=795; Antisense; GAAACTGGAACGTCTAACTCACTTG
>probe:Drosophila_2:1623508_at:657:207; Interrogation_Position=823; Antisense; AAGCTATTTCTTTGTGGTCACGTTA
>probe:Drosophila_2:1623508_at:312:101; Interrogation_Position=862; Antisense; AGAGAGATTCTCATAGCTGCGAAGA
>probe:Drosophila_2:1623508_at:530:339; Interrogation_Position=979; Antisense; GCTAATTTTGGTATGCATGCGTATC
>probe:Drosophila_2:1623508_at:624:623; Interrogation_Position=996; Antisense; TGCGTATCAGCATCTTCACATTAAT

Paste this into a BLAST search page for me
CTAAACACACACGAGGTCCTGGGTAGTATATACCATTGCACCTTCGGATTAAGGAGTTCACATTCGATGCGAAGAGGGAGAAAACCGTACCACAGCACTTGGAACTAAACACGTATCTCATGTCTAATCCCTGAAGCTGGGTATCTTCGAGATTTCGAACACAGAACTGCCCTGGATTAGAAACCTAGAGCAGCTGCAGTGATGGTGTGGTTCCTATCGAAACTGGAAACTGGAACGTCTAACTCACTTGAAGCTATTTCTTTGTGGTCACGTTAAGAGAGATTCTCATAGCTGCGAAGAGCTAATTTTGGTATGCATGCGTATCTGCGTATCAGCATCTTCACATTAAT

Full Affymetrix probeset data:

Annotations for 1623508_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720