FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623510_at:

>probe:Drosophila_2:1623510_at:75:713; Interrogation_Position=316; Antisense; TTCAGCCAGGATGTGCGCTTCCGAA
>probe:Drosophila_2:1623510_at:11:375; Interrogation_Position=338; Antisense; GAAGATTCTTCCTGTTCCTGTCCGA
>probe:Drosophila_2:1623510_at:266:123; Interrogation_Position=362; Antisense; AGCGACTGGTCTATGCTCCGATTTA
>probe:Drosophila_2:1623510_at:447:683; Interrogation_Position=373; Antisense; TATGCTCCGATTTACCAGGCACTGT
>probe:Drosophila_2:1623510_at:388:219; Interrogation_Position=427; Antisense; AAGTCTCCCAGCACTGCATTGAAGA
>probe:Drosophila_2:1623510_at:410:59; Interrogation_Position=452; Antisense; ATGTTGAGAAGCTCTACTGGCCTCT
>probe:Drosophila_2:1623510_at:45:197; Interrogation_Position=487; Antisense; AACTGGCAGTACCTGTCCGTGTTCG
>probe:Drosophila_2:1623510_at:523:275; Interrogation_Position=573; Antisense; CTTCATCTGGGTGGTGTACATCGCC
>probe:Drosophila_2:1623510_at:665:633; Interrogation_Position=649; Antisense; TAGGCTATACGACCCTTAAACCCTG
>probe:Drosophila_2:1623510_at:331:661; Interrogation_Position=665; Antisense; TAAACCCTGTGGTAGTCGTCTTGGC
>probe:Drosophila_2:1623510_at:353:499; Interrogation_Position=679; Antisense; GTCGTCTTGGCCTAATATTCCAATT
>probe:Drosophila_2:1623510_at:84:463; Interrogation_Position=712; Antisense; GATTACGGCTGAACTGCTTCAAGTT
>probe:Drosophila_2:1623510_at:525:709; Interrogation_Position=729; Antisense; TTCAAGTTCTTTATCTTCCCGCGTT
>probe:Drosophila_2:1623510_at:251:321; Interrogation_Position=819; Antisense; GCGCCTTATCAACCGACTGTTGTTA

Paste this into a BLAST search page for me
TTCAGCCAGGATGTGCGCTTCCGAAGAAGATTCTTCCTGTTCCTGTCCGAAGCGACTGGTCTATGCTCCGATTTATATGCTCCGATTTACCAGGCACTGTAAGTCTCCCAGCACTGCATTGAAGAATGTTGAGAAGCTCTACTGGCCTCTAACTGGCAGTACCTGTCCGTGTTCGCTTCATCTGGGTGGTGTACATCGCCTAGGCTATACGACCCTTAAACCCTGTAAACCCTGTGGTAGTCGTCTTGGCGTCGTCTTGGCCTAATATTCCAATTGATTACGGCTGAACTGCTTCAAGTTTTCAAGTTCTTTATCTTCCCGCGTTGCGCCTTATCAACCGACTGTTGTTA

Full Affymetrix probeset data:

Annotations for 1623510_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720