FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623513_at:

>probe:Drosophila_2:1623513_at:639:357; Interrogation_Position=4246; Antisense; GCAAATCACTGTAGGCTGCCAGGAT
>probe:Drosophila_2:1623513_at:268:119; Interrogation_Position=4275; Antisense; AGCTGCAGTTGCTGTTTCCGTAGCG
>probe:Drosophila_2:1623513_at:279:431; Interrogation_Position=4312; Antisense; GAGTCATAGCCAGGCGACATGCCAT
>probe:Drosophila_2:1623513_at:448:3; Interrogation_Position=4349; Antisense; ATTGGCCATTGGTCACGAGTGCGCT
>probe:Drosophila_2:1623513_at:228:549; Interrogation_Position=4382; Antisense; GGAGTTCGCCCACGGATGAGCCAAT
>probe:Drosophila_2:1623513_at:428:287; Interrogation_Position=4394; Antisense; CGGATGAGCCAATCTGCCAGCAAGG
>probe:Drosophila_2:1623513_at:323:99; Interrogation_Position=4428; Antisense; AGATGGACAACTTCTCGACACGTTT
>probe:Drosophila_2:1623513_at:386:399; Interrogation_Position=4444; Antisense; GACACGTTTCTTTTCTCTTTTGCCA
>probe:Drosophila_2:1623513_at:221:9; Interrogation_Position=4476; Antisense; ATTCGCAGCCGGAGCCTAACAAAGA
>probe:Drosophila_2:1623513_at:23:301; Interrogation_Position=4513; Antisense; CGCCCAGGACATGTATTCACCAAGT
>probe:Drosophila_2:1623513_at:215:221; Interrogation_Position=4534; Antisense; AAGTGGCTTATCTTCTAACCTTCTT
>probe:Drosophila_2:1623513_at:610:309; Interrogation_Position=4577; Antisense; GCCAATCTTTAGCTCCTGTTTTAAC
>probe:Drosophila_2:1623513_at:315:535; Interrogation_Position=4619; Antisense; GGTTTATACCGATCCCCATATATGT
>probe:Drosophila_2:1623513_at:11:485; Interrogation_Position=4642; Antisense; GTATGCCCACTGTTGTACATTTTTG

Paste this into a BLAST search page for me
GCAAATCACTGTAGGCTGCCAGGATAGCTGCAGTTGCTGTTTCCGTAGCGGAGTCATAGCCAGGCGACATGCCATATTGGCCATTGGTCACGAGTGCGCTGGAGTTCGCCCACGGATGAGCCAATCGGATGAGCCAATCTGCCAGCAAGGAGATGGACAACTTCTCGACACGTTTGACACGTTTCTTTTCTCTTTTGCCAATTCGCAGCCGGAGCCTAACAAAGACGCCCAGGACATGTATTCACCAAGTAAGTGGCTTATCTTCTAACCTTCTTGCCAATCTTTAGCTCCTGTTTTAACGGTTTATACCGATCCCCATATATGTGTATGCCCACTGTTGTACATTTTTG

Full Affymetrix probeset data:

Annotations for 1623513_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720