Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623514_a_at:

>probe:Drosophila_2:1623514_a_at:301:195; Interrogation_Position=105; Antisense; AACTGACGCAATGAGCGCCGTTGAT
>probe:Drosophila_2:1623514_a_at:166:417; Interrogation_Position=117; Antisense; GAGCGCCGTTGATGCTATAATCAAT
>probe:Drosophila_2:1623514_a_at:447:243; Interrogation_Position=139; Antisense; AATTACAAGCGCAGTCCCAACGAGG
>probe:Drosophila_2:1623514_a_at:290:311; Interrogation_Position=155; Antisense; CCAACGAGGACTTCTACGGTCTGCT
>probe:Drosophila_2:1623514_a_at:361:141; Interrogation_Position=170; Antisense; ACGGTCTGCTCCATTGCGATGAGAA
>probe:Drosophila_2:1623514_a_at:104:57; Interrogation_Position=188; Antisense; ATGAGAACTCATCGCCCGAGCAGAT
>probe:Drosophila_2:1623514_a_at:625:295; Interrogation_Position=204; Antisense; CGAGCAGATCCAGGCCGAGTACAAA
>probe:Drosophila_2:1623514_a_at:64:431; Interrogation_Position=220; Antisense; GAGTACAAAGTCCTGGCCCTTCAGT
>probe:Drosophila_2:1623514_a_at:288:331; Interrogation_Position=277; Antisense; GCGGAGGCCAAGTTCCAGCAGTTAA
>probe:Drosophila_2:1623514_a_at:318:391; Interrogation_Position=313; Antisense; GAAACCTTGTGCGATCCCGAAAAGA
>probe:Drosophila_2:1623514_a_at:575:181; Interrogation_Position=332; Antisense; AAAAGAGGGCCATCTACGACAAGTG
>probe:Drosophila_2:1623514_a_at:704:187; Interrogation_Position=361; Antisense; AACAGCGGCATCTCGATGAGCTACA
>probe:Drosophila_2:1623514_a_at:296:609; Interrogation_Position=377; Antisense; TGAGCTACAAACAGTGGCTGGGCAT
>probe:Drosophila_2:1623514_a_at:556:411; Interrogation_Position=89; Antisense; GACCGATCCCAGGAATAACTGACGC

Paste this into a BLAST search page for me
AACTGACGCAATGAGCGCCGTTGATGAGCGCCGTTGATGCTATAATCAATAATTACAAGCGCAGTCCCAACGAGGCCAACGAGGACTTCTACGGTCTGCTACGGTCTGCTCCATTGCGATGAGAAATGAGAACTCATCGCCCGAGCAGATCGAGCAGATCCAGGCCGAGTACAAAGAGTACAAAGTCCTGGCCCTTCAGTGCGGAGGCCAAGTTCCAGCAGTTAAGAAACCTTGTGCGATCCCGAAAAGAAAAAGAGGGCCATCTACGACAAGTGAACAGCGGCATCTCGATGAGCTACATGAGCTACAAACAGTGGCTGGGCATGACCGATCCCAGGAATAACTGACGC

Full Affymetrix probeset data:

Annotations for 1623514_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime