FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623517_at:

>probe:Drosophila_2:1623517_at:406:1; Interrogation_Position=264; Antisense; CTCCTATGCCAACACCTACAAGGTG
>probe:Drosophila_2:1623517_at:366:227; Interrogation_Position=295; Antisense; AAGGCCATTCCAGTGGTCCATGCCG
>probe:Drosophila_2:1623517_at:530:269; Interrogation_Position=367; Antisense; CATGGATCCTATGGCGGCTACGGTA
>probe:Drosophila_2:1623517_at:441:339; Interrogation_Position=383; Antisense; GCTACGGTAGCTACGGTCTGGGATA
>probe:Drosophila_2:1623517_at:312:455; Interrogation_Position=404; Antisense; GATACGCCGGCTACGGACACGGAGC
>probe:Drosophila_2:1623517_at:274:415; Interrogation_Position=425; Antisense; GAGCCTACCTGCACTAAGGATCTGG
>probe:Drosophila_2:1623517_at:33:549; Interrogation_Position=448; Antisense; GGATGTCGGAAAGGATACCAGCCCC
>probe:Drosophila_2:1623517_at:315:611; Interrogation_Position=477; Antisense; TGACGACCCCGATTGAAGTGAGAAC
>probe:Drosophila_2:1623517_at:331:543; Interrogation_Position=509; Antisense; GGATAATTCGCATTTTGCTGCCGTC
>probe:Drosophila_2:1623517_at:151:693; Interrogation_Position=522; Antisense; TTTGCTGCCGTCAAAGTGTTGAATT
>probe:Drosophila_2:1623517_at:296:363; Interrogation_Position=542; Antisense; GAATTTGCATTTCGTAGTCAGAAGC
>probe:Drosophila_2:1623517_at:433:105; Interrogation_Position=604; Antisense; AGACACCCACTTGGAGACAGAGACA
>probe:Drosophila_2:1623517_at:419:65; Interrogation_Position=712; Antisense; ATGGTGCAACTCCATGCATTGTGGC
>probe:Drosophila_2:1623517_at:579:343; Interrogation_Position=727; Antisense; GCATTGTGGCTTCATAACATTTTGT

Paste this into a BLAST search page for me
CTCCTATGCCAACACCTACAAGGTGAAGGCCATTCCAGTGGTCCATGCCGCATGGATCCTATGGCGGCTACGGTAGCTACGGTAGCTACGGTCTGGGATAGATACGCCGGCTACGGACACGGAGCGAGCCTACCTGCACTAAGGATCTGGGGATGTCGGAAAGGATACCAGCCCCTGACGACCCCGATTGAAGTGAGAACGGATAATTCGCATTTTGCTGCCGTCTTTGCTGCCGTCAAAGTGTTGAATTGAATTTGCATTTCGTAGTCAGAAGCAGACACCCACTTGGAGACAGAGACAATGGTGCAACTCCATGCATTGTGGCGCATTGTGGCTTCATAACATTTTGT

Full Affymetrix probeset data:

Annotations for 1623517_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720