FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623519_at:

>probe:Drosophila_2:1623519_at:476:143; Interrogation_Position=1159; Antisense; ACTCCTCCTGCACGATAATTGCGGA
>probe:Drosophila_2:1623519_at:345:41; Interrogation_Position=1206; Antisense; ATCTGGTTCGTGAGATTCGGCTTCA
>probe:Drosophila_2:1623519_at:410:463; Interrogation_Position=1219; Antisense; GATTCGGCTTCAATCCGTGGCAGAA
>probe:Drosophila_2:1623519_at:647:161; Interrogation_Position=1333; Antisense; ACAATTCGCGTAGCGTGGCCACTGT
>probe:Drosophila_2:1623519_at:4:671; Interrogation_Position=1390; Antisense; TACTGGTCTACGTGTGCGATGACGC
>probe:Drosophila_2:1623519_at:604:191; Interrogation_Position=1445; Antisense; AACTTCCATCTGATGGCGCAGCTGG
>probe:Drosophila_2:1623519_at:378:119; Interrogation_Position=1464; Antisense; AGCTGGGCGCAACCACAAACCAAAT
>probe:Drosophila_2:1623519_at:296:255; Interrogation_Position=1484; Antisense; CAAATCTCACGTGGCCAAAACTTAC
>probe:Drosophila_2:1623519_at:559:271; Interrogation_Position=1511; Antisense; CATTTCCCTCAATTAGTTCCTAGTT
>probe:Drosophila_2:1623519_at:580:95; Interrogation_Position=1547; Antisense; AGATATAGAATTACGCTCCTGTGCT
>probe:Drosophila_2:1623519_at:498:337; Interrogation_Position=1561; Antisense; GCTCCTGTGCTGTTCCAAATTATTT
>probe:Drosophila_2:1623519_at:255:205; Interrogation_Position=1628; Antisense; AAGCCGGTTGCTTTTTAGATGTAAG
>probe:Drosophila_2:1623519_at:10:243; Interrogation_Position=1657; Antisense; AATAGTTGTTGCTTACTCTGCTGCC
>probe:Drosophila_2:1623519_at:715:145; Interrogation_Position=1671; Antisense; ACTCTGCTGCCTTTATTTATTGTAA

Paste this into a BLAST search page for me
ACTCCTCCTGCACGATAATTGCGGAATCTGGTTCGTGAGATTCGGCTTCAGATTCGGCTTCAATCCGTGGCAGAAACAATTCGCGTAGCGTGGCCACTGTTACTGGTCTACGTGTGCGATGACGCAACTTCCATCTGATGGCGCAGCTGGAGCTGGGCGCAACCACAAACCAAATCAAATCTCACGTGGCCAAAACTTACCATTTCCCTCAATTAGTTCCTAGTTAGATATAGAATTACGCTCCTGTGCTGCTCCTGTGCTGTTCCAAATTATTTAAGCCGGTTGCTTTTTAGATGTAAGAATAGTTGTTGCTTACTCTGCTGCCACTCTGCTGCCTTTATTTATTGTAA

Full Affymetrix probeset data:

Annotations for 1623519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720