FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623521_at:

>probe:Drosophila_2:1623521_at:535:37; Interrogation_Position=1413; Antisense; ATCTTCGTGCGCATCGTGGACAAGG
>probe:Drosophila_2:1623521_at:421:529; Interrogation_Position=1448; Antisense; GGGATGGAACAACGGCCTGCTCACA
>probe:Drosophila_2:1623521_at:23:157; Interrogation_Position=1470; Antisense; ACACTGATCTCTTCGATGCTGCAAA
>probe:Drosophila_2:1623521_at:245:611; Interrogation_Position=1495; Antisense; TGAACCTCAACGGTTATCCTTTCGT
>probe:Drosophila_2:1623521_at:566:717; Interrogation_Position=1515; Antisense; TTCGTCCTTCCCGATATGATTGGTG
>probe:Drosophila_2:1623521_at:628:291; Interrogation_Position=1631; Antisense; CGTTCCCTGGAACTTTGACGACGAG
>probe:Drosophila_2:1623521_at:86:137; Interrogation_Position=1648; Antisense; ACGACGAGGCCATTGCGATCAGCAA
>probe:Drosophila_2:1623521_at:15:311; Interrogation_Position=1692; Antisense; GCCACCTATACACCTTACATTATGA
>probe:Drosophila_2:1623521_at:398:205; Interrogation_Position=1725; Antisense; AAGCGCGCTGTGGATTCTGGTGAAC
>probe:Drosophila_2:1623521_at:525:591; Interrogation_Position=1742; Antisense; TGGTGAACCTGTGAATGTTCCCCTC
>probe:Drosophila_2:1623521_at:393:607; Interrogation_Position=1787; Antisense; TGAGGTGGCGCAGTCTATCTATGAT
>probe:Drosophila_2:1623521_at:654:443; Interrogation_Position=1809; Antisense; GATGAGTTCCTTTTGGGCGAAGACA
>probe:Drosophila_2:1623521_at:151:207; Interrogation_Position=1869; Antisense; AAGCGAGACATTTACCTGCCAGAGG
>probe:Drosophila_2:1623521_at:224:667; Interrogation_Position=1980; Antisense; TACTTTTTGCGCGTGGGATTCACAC

Paste this into a BLAST search page for me
ATCTTCGTGCGCATCGTGGACAAGGGGGATGGAACAACGGCCTGCTCACAACACTGATCTCTTCGATGCTGCAAATGAACCTCAACGGTTATCCTTTCGTTTCGTCCTTCCCGATATGATTGGTGCGTTCCCTGGAACTTTGACGACGAGACGACGAGGCCATTGCGATCAGCAAGCCACCTATACACCTTACATTATGAAAGCGCGCTGTGGATTCTGGTGAACTGGTGAACCTGTGAATGTTCCCCTCTGAGGTGGCGCAGTCTATCTATGATGATGAGTTCCTTTTGGGCGAAGACAAAGCGAGACATTTACCTGCCAGAGGTACTTTTTGCGCGTGGGATTCACAC

Full Affymetrix probeset data:

Annotations for 1623521_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720