Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623522_at:

>probe:Drosophila_2:1623522_at:101:405; Interrogation_Position=1006; Antisense; GACTACTCCGGCAATATGGACACAT
>probe:Drosophila_2:1623522_at:66:45; Interrogation_Position=1082; Antisense; ATCGCCATACGATACCCTATGTGGT
>probe:Drosophila_2:1623522_at:425:271; Interrogation_Position=1098; Antisense; CTATGTGGTGGGTATAACGTCCTTT
>probe:Drosophila_2:1623522_at:339:589; Interrogation_Position=1122; Antisense; TGGAGGAGCCTGTGCATCCGGTCAA
>probe:Drosophila_2:1623522_at:725:615; Interrogation_Position=1134; Antisense; TGCATCCGGTCAACCTGGAGTTTAT
>probe:Drosophila_2:1623522_at:168:91; Interrogation_Position=1197; Antisense; AGTATGGCCTTGATTCTTTTGAGAA
>probe:Drosophila_2:1623522_at:685:635; Interrogation_Position=737; Antisense; TCGATGCGGAGACCCTTACCAATGA
>probe:Drosophila_2:1623522_at:119:375; Interrogation_Position=785; Antisense; GAAGATCACACATGCCAGTGGCCTG
>probe:Drosophila_2:1623522_at:555:83; Interrogation_Position=801; Antisense; AGTGGCCTGCCTGTGGAACCAGGAA
>probe:Drosophila_2:1623522_at:159:145; Interrogation_Position=847; Antisense; ACTGCCCTGGGCTATGGACAAACCA
>probe:Drosophila_2:1623522_at:711:395; Interrogation_Position=863; Antisense; GACAAACCAAGTTCGCTGGACCACA
>probe:Drosophila_2:1623522_at:617:47; Interrogation_Position=910; Antisense; ATGCTTTACCACCTGAATTTCCAAC
>probe:Drosophila_2:1623522_at:224:313; Interrogation_Position=938; Antisense; GCCAGAGGTACTTGCACAACTATGA
>probe:Drosophila_2:1623522_at:634:309; Interrogation_Position=971; Antisense; CCAATGGCCTGGGATCGGGTCAAAT

Paste this into a BLAST search page for me
GACTACTCCGGCAATATGGACACATATCGCCATACGATACCCTATGTGGTCTATGTGGTGGGTATAACGTCCTTTTGGAGGAGCCTGTGCATCCGGTCAATGCATCCGGTCAACCTGGAGTTTATAGTATGGCCTTGATTCTTTTGAGAATCGATGCGGAGACCCTTACCAATGAGAAGATCACACATGCCAGTGGCCTGAGTGGCCTGCCTGTGGAACCAGGAAACTGCCCTGGGCTATGGACAAACCAGACAAACCAAGTTCGCTGGACCACAATGCTTTACCACCTGAATTTCCAACGCCAGAGGTACTTGCACAACTATGACCAATGGCCTGGGATCGGGTCAAAT

Full Affymetrix probeset data:

Annotations for 1623522_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime