FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623523_at:

>probe:Drosophila_2:1623523_at:486:603; Interrogation_Position=1073; Antisense; TGTTGCCCCATCTGAAGGATCTCAA
>probe:Drosophila_2:1623523_at:291:379; Interrogation_Position=1171; Antisense; GAAGCGGAACTCAATTGCGGCCAGT
>probe:Drosophila_2:1623523_at:485:13; Interrogation_Position=1254; Antisense; ATTAGTTGGAGATCCTCGAGGGCCA
>probe:Drosophila_2:1623523_at:419:163; Interrogation_Position=701; Antisense; AAATAGATCATCTCTCGCTCTCGTT
>probe:Drosophila_2:1623523_at:499:281; Interrogation_Position=718; Antisense; CTCTCGTTTAATCCTCAACTCAGAA
>probe:Drosophila_2:1623523_at:318:375; Interrogation_Position=740; Antisense; GAAGACTCCATCTATCAGCTAAAAT
>probe:Drosophila_2:1623523_at:589:439; Interrogation_Position=775; Antisense; GAGGCCACCAATTGTGATCTCGAGT
>probe:Drosophila_2:1623523_at:686:437; Interrogation_Position=838; Antisense; GAGGCAAACCCAAAGCTGCATGAGT
>probe:Drosophila_2:1623523_at:41:57; Interrogation_Position=857; Antisense; ATGAGTTGAAGATTTCGCAGCCCCA
>probe:Drosophila_2:1623523_at:147:553; Interrogation_Position=888; Antisense; GGAGCATCTTTACTTGGCCAATACC
>probe:Drosophila_2:1623523_at:190:103; Interrogation_Position=922; Antisense; AGACTTGACTTTCTGTCCAAGGCCA
>probe:Drosophila_2:1623523_at:474:579; Interrogation_Position=942; Antisense; GGCCAGTAAGCTCGTTGACTTGGAT
>probe:Drosophila_2:1623523_at:446:141; Interrogation_Position=970; Antisense; ACGGACATTGTAAATCTCGCGGATT
>probe:Drosophila_2:1623523_at:326:697; Interrogation_Position=993; Antisense; TTTACCCAAAATTACCTCAGCCAAG

Paste this into a BLAST search page for me
TGTTGCCCCATCTGAAGGATCTCAAGAAGCGGAACTCAATTGCGGCCAGTATTAGTTGGAGATCCTCGAGGGCCAAAATAGATCATCTCTCGCTCTCGTTCTCTCGTTTAATCCTCAACTCAGAAGAAGACTCCATCTATCAGCTAAAATGAGGCCACCAATTGTGATCTCGAGTGAGGCAAACCCAAAGCTGCATGAGTATGAGTTGAAGATTTCGCAGCCCCAGGAGCATCTTTACTTGGCCAATACCAGACTTGACTTTCTGTCCAAGGCCAGGCCAGTAAGCTCGTTGACTTGGATACGGACATTGTAAATCTCGCGGATTTTTACCCAAAATTACCTCAGCCAAG

Full Affymetrix probeset data:

Annotations for 1623523_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720