FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623524_at:

>probe:Drosophila_2:1623524_at:535:215; Interrogation_Position=1227; Antisense; AAGATACCCATATCGCATGCGGTCA
>probe:Drosophila_2:1623524_at:164:37; Interrogation_Position=1251; Antisense; ATCATACCGGTTCGCAAGCCAGTGC
>probe:Drosophila_2:1623524_at:649:209; Interrogation_Position=1296; Antisense; AAGAATGTTCACGTGCCGGTGGAGA
>probe:Drosophila_2:1623524_at:13:143; Interrogation_Position=1346; Antisense; ACTGATTCCTGTGCCCGTGGAGAAA
>probe:Drosophila_2:1623524_at:329:551; Interrogation_Position=1364; Antisense; GGAGAAACACATCCCAGTACCGGTG
>probe:Drosophila_2:1623524_at:564:487; Interrogation_Position=1380; Antisense; GTACCGGTGGAGAAGCATGTGCCCT
>probe:Drosophila_2:1623524_at:136:349; Interrogation_Position=1394; Antisense; GCATGTGCCCTATCATGTGGTCAAA
>probe:Drosophila_2:1623524_at:193:615; Interrogation_Position=1453; Antisense; TGAAGGTGCCCGTCTTCAAGACAGT
>probe:Drosophila_2:1623524_at:590:257; Interrogation_Position=1519; Antisense; CACTTTTATAAATCCCATCCTGCAT
>probe:Drosophila_2:1623524_at:716:47; Interrogation_Position=1535; Antisense; ATCCTGCATTTCTGCATTTCTGCAC
>probe:Drosophila_2:1623524_at:676:345; Interrogation_Position=1569; Antisense; GCATCCAGAGCACGCGAATTTCGTT
>probe:Drosophila_2:1623524_at:23:45; Interrogation_Position=1630; Antisense; ATCCCAGCCTTTTGTGTCAGCAAAC
>probe:Drosophila_2:1623524_at:676:349; Interrogation_Position=1673; Antisense; GCAGTTTTGCACATTTCGTATTCCA
>probe:Drosophila_2:1623524_at:515:245; Interrogation_Position=1718; Antisense; AATTCATTTAATCCCCGTGATGTAC

Paste this into a BLAST search page for me
AAGATACCCATATCGCATGCGGTCAATCATACCGGTTCGCAAGCCAGTGCAAGAATGTTCACGTGCCGGTGGAGAACTGATTCCTGTGCCCGTGGAGAAAGGAGAAACACATCCCAGTACCGGTGGTACCGGTGGAGAAGCATGTGCCCTGCATGTGCCCTATCATGTGGTCAAATGAAGGTGCCCGTCTTCAAGACAGTCACTTTTATAAATCCCATCCTGCATATCCTGCATTTCTGCATTTCTGCACGCATCCAGAGCACGCGAATTTCGTTATCCCAGCCTTTTGTGTCAGCAAACGCAGTTTTGCACATTTCGTATTCCAAATTCATTTAATCCCCGTGATGTAC

Full Affymetrix probeset data:

Annotations for 1623524_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720