FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623525_at:

>probe:Drosophila_2:1623525_at:689:683; Interrogation_Position=3295; Antisense; TATGCCAAAGATCTGCAGCCACCCG
>probe:Drosophila_2:1623525_at:256:319; Interrogation_Position=3321; Antisense; GCCGCCAATGGGAAAGCCGACACAT
>probe:Drosophila_2:1623525_at:200:175; Interrogation_Position=3333; Antisense; AAAGCCGACACATGGGCGCCTGTTG
>probe:Drosophila_2:1623525_at:301:723; Interrogation_Position=3355; Antisense; TTGCGCCAGCGACCACAGAAGCAGT
>probe:Drosophila_2:1623525_at:42:353; Interrogation_Position=3431; Antisense; GCAGCAACGGCATTGGAGCCCCAGG
>probe:Drosophila_2:1623525_at:655:267; Interrogation_Position=3452; Antisense; CAGGACATTCCATGCTGGACTTGAA
>probe:Drosophila_2:1623525_at:655:249; Interrogation_Position=3489; Antisense; CAAGTACTTTGGTGGCGCTATGAAT
>probe:Drosophila_2:1623525_at:728:25; Interrogation_Position=3517; Antisense; ATAGATGCTGGTGAGCCCTTTGCCA
>probe:Drosophila_2:1623525_at:143:197; Interrogation_Position=3612; Antisense; AACGGCGATTGGATTGCTTGGAAAT
>probe:Drosophila_2:1623525_at:669:395; Interrogation_Position=3632; Antisense; GAAATTGAACCCTTTGGCATACCGA
>probe:Drosophila_2:1623525_at:259:19; Interrogation_Position=3681; Antisense; ATTTCCATTATCATTTCTTTTCGTT
>probe:Drosophila_2:1623525_at:158:13; Interrogation_Position=3713; Antisense; ATTAATGAACGCTGCCAACTACGGG
>probe:Drosophila_2:1623525_at:334:277; Interrogation_Position=3731; Antisense; CTACGGGCCTCTTTATTTGTTAATG
>probe:Drosophila_2:1623525_at:330:703; Interrogation_Position=3765; Antisense; TTATTACCAACCCACTGCCAAAATA

Paste this into a BLAST search page for me
TATGCCAAAGATCTGCAGCCACCCGGCCGCCAATGGGAAAGCCGACACATAAAGCCGACACATGGGCGCCTGTTGTTGCGCCAGCGACCACAGAAGCAGTGCAGCAACGGCATTGGAGCCCCAGGCAGGACATTCCATGCTGGACTTGAACAAGTACTTTGGTGGCGCTATGAATATAGATGCTGGTGAGCCCTTTGCCAAACGGCGATTGGATTGCTTGGAAATGAAATTGAACCCTTTGGCATACCGAATTTCCATTATCATTTCTTTTCGTTATTAATGAACGCTGCCAACTACGGGCTACGGGCCTCTTTATTTGTTAATGTTATTACCAACCCACTGCCAAAATA

Full Affymetrix probeset data:

Annotations for 1623525_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720