FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623526_at:

>probe:Drosophila_2:1623526_at:663:419; Interrogation_Position=15; Antisense; GAGCATATCGGCCAGAACGATTAAC
>probe:Drosophila_2:1623526_at:368:41; Interrogation_Position=21; Antisense; ATCGGCCAGAACGATTAACGCTCCT
>probe:Drosophila_2:1623526_at:589:313; Interrogation_Position=25; Antisense; GCCAGAACGATTAACGCTCCTCTGA
>probe:Drosophila_2:1623526_at:140:383; Interrogation_Position=29; Antisense; GAACGATTAACGCTCCTCTGATAAA
>probe:Drosophila_2:1623526_at:711:137; Interrogation_Position=31; Antisense; ACGATTAACGCTCCTCTGATAAAAC
>probe:Drosophila_2:1623526_at:315:461; Interrogation_Position=33; Antisense; GATTAACGCTCCTCTGATAAAACAC
>probe:Drosophila_2:1623526_at:44:711; Interrogation_Position=35; Antisense; TTAACGCTCCTCTGATAAAACACAT
>probe:Drosophila_2:1623526_at:262:199; Interrogation_Position=37; Antisense; AACGCTCCTCTGATAAAACACATTA
>probe:Drosophila_2:1623526_at:519:337; Interrogation_Position=40; Antisense; GCTCCTCTGATAAAACACATTATTG
>probe:Drosophila_2:1623526_at:297:273; Interrogation_Position=57; Antisense; CATTATTGATTTGGGTGGTTCCTAC
>probe:Drosophila_2:1623526_at:268:7; Interrogation_Position=61; Antisense; ATTGATTTGGGTGGTTCCTACGGCG
>probe:Drosophila_2:1623526_at:717:467; Interrogation_Position=74; Antisense; GTTCCTACGGCGGAGCAGGCGACAA
>probe:Drosophila_2:1623526_at:299:631; Interrogation_Position=76; Antisense; TCCTACGGCGGAGCAGGCGACAATG
>probe:Drosophila_2:1623526_at:526:419; Interrogation_Position=86; Antisense; GAGCAGGCGACAATGGAGCCTACTA

Paste this into a BLAST search page for me
GAGCATATCGGCCAGAACGATTAACATCGGCCAGAACGATTAACGCTCCTGCCAGAACGATTAACGCTCCTCTGAGAACGATTAACGCTCCTCTGATAAAACGATTAACGCTCCTCTGATAAAACGATTAACGCTCCTCTGATAAAACACTTAACGCTCCTCTGATAAAACACATAACGCTCCTCTGATAAAACACATTAGCTCCTCTGATAAAACACATTATTGCATTATTGATTTGGGTGGTTCCTACATTGATTTGGGTGGTTCCTACGGCGGTTCCTACGGCGGAGCAGGCGACAATCCTACGGCGGAGCAGGCGACAATGGAGCAGGCGACAATGGAGCCTACTA

Full Affymetrix probeset data:

Annotations for 1623526_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720