Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623529_s_at:

>probe:Drosophila_2:1623529_s_at:373:135; Interrogation_Position=1041; Antisense; ACGCTGCCAGATTCCAATGATCCTG
>probe:Drosophila_2:1623529_s_at:685:229; Interrogation_Position=1056; Antisense; AATGATCCTGGTCTCCGGCGTAATT
>probe:Drosophila_2:1623529_s_at:544:505; Interrogation_Position=1081; Antisense; GTGCCCATCAGCATGAAGACCTTCA
>probe:Drosophila_2:1623529_s_at:270:223; Interrogation_Position=1117; Antisense; AAGGGAGCGTACACCATGCTTACTC
>probe:Drosophila_2:1623529_s_at:123:149; Interrogation_Position=579; Antisense; ACTTGTCCTCAATCTGAGCTCCTAT
>probe:Drosophila_2:1623529_s_at:111:257; Interrogation_Position=663; Antisense; CAAATTGGGATATGGCGCGCCACTA
>probe:Drosophila_2:1623529_s_at:175:541; Interrogation_Position=693; Antisense; GGTTCGGATGCAGGCCATTCTGGTT
>probe:Drosophila_2:1623529_s_at:6:719; Interrogation_Position=745; Antisense; TTGCGCCTCTTCAAGTCACTGGAGA
>probe:Drosophila_2:1623529_s_at:17:589; Interrogation_Position=764; Antisense; TGGAGAGATCCCTTTCGATGACCTG
>probe:Drosophila_2:1623529_s_at:393:55; Interrogation_Position=781; Antisense; ATGACCTGCTTTCTGCAGTTCTTCA
>probe:Drosophila_2:1623529_s_at:20:617; Interrogation_Position=823; Antisense; TGCACAATCTGCTACTTTCTACTCT
>probe:Drosophila_2:1623529_s_at:189:669; Interrogation_Position=842; Antisense; TACTCTTCGGGAACGTCGGGATCAT
>probe:Drosophila_2:1623529_s_at:180:603; Interrogation_Position=881; Antisense; TGTTGTTCCTGCTGGTGATCCTCAC
>probe:Drosophila_2:1623529_s_at:420:259; Interrogation_Position=930; Antisense; CACGGCGGAGCTACCTTGCAAGGAA

Paste this into a BLAST search page for me
ACGCTGCCAGATTCCAATGATCCTGAATGATCCTGGTCTCCGGCGTAATTGTGCCCATCAGCATGAAGACCTTCAAAGGGAGCGTACACCATGCTTACTCACTTGTCCTCAATCTGAGCTCCTATCAAATTGGGATATGGCGCGCCACTAGGTTCGGATGCAGGCCATTCTGGTTTTGCGCCTCTTCAAGTCACTGGAGATGGAGAGATCCCTTTCGATGACCTGATGACCTGCTTTCTGCAGTTCTTCATGCACAATCTGCTACTTTCTACTCTTACTCTTCGGGAACGTCGGGATCATTGTTGTTCCTGCTGGTGATCCTCACCACGGCGGAGCTACCTTGCAAGGAA

Full Affymetrix probeset data:

Annotations for 1623529_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime