FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623531_at:

>probe:Drosophila_2:1623531_at:533:379; Interrogation_Position=1027; Antisense; GAACCTCATGTGGAACCTCATTTCT
>probe:Drosophila_2:1623531_at:441:201; Interrogation_Position=1102; Antisense; AAGCCATCAGTCTCCAAACATACGG
>probe:Drosophila_2:1623531_at:20:557; Interrogation_Position=1130; Antisense; GGACGAATCTCAATCCTGATCACGA
>probe:Drosophila_2:1623531_at:578:21; Interrogation_Position=1220; Antisense; ATATCACCGTTTTTCGCGATTTCTT
>probe:Drosophila_2:1623531_at:534:327; Interrogation_Position=1235; Antisense; GCGATTTCTTATGCTGCTATATGCC
>probe:Drosophila_2:1623531_at:267:193; Interrogation_Position=775; Antisense; AACTCCACCGGGTGCGGTACATATA
>probe:Drosophila_2:1623531_at:391:25; Interrogation_Position=797; Antisense; ATAGCGACCTATTTGAAACGACCTC
>probe:Drosophila_2:1623531_at:701:135; Interrogation_Position=814; Antisense; ACGACCTCAGCAGAGTCTTACACAT
>probe:Drosophila_2:1623531_at:122:521; Interrogation_Position=865; Antisense; GTGGAAAGCACCTGTCAGCACTGTA
>probe:Drosophila_2:1623531_at:73:107; Interrogation_Position=881; Antisense; AGCACTGTAAGTCACAACCGACCTG
>probe:Drosophila_2:1623531_at:334:413; Interrogation_Position=900; Antisense; GACCTGCACGGATCAGACGTTGATA
>probe:Drosophila_2:1623531_at:321:455; Interrogation_Position=921; Antisense; GATAGTACCAATGCAACCTCAAGTT
>probe:Drosophila_2:1623531_at:668:113; Interrogation_Position=968; Antisense; AGCAGCCTTGCACATCTAGACATAT
>probe:Drosophila_2:1623531_at:431:105; Interrogation_Position=985; Antisense; AGACATATCCGCTTTGATCTCTGCA

Paste this into a BLAST search page for me
GAACCTCATGTGGAACCTCATTTCTAAGCCATCAGTCTCCAAACATACGGGGACGAATCTCAATCCTGATCACGAATATCACCGTTTTTCGCGATTTCTTGCGATTTCTTATGCTGCTATATGCCAACTCCACCGGGTGCGGTACATATAATAGCGACCTATTTGAAACGACCTCACGACCTCAGCAGAGTCTTACACATGTGGAAAGCACCTGTCAGCACTGTAAGCACTGTAAGTCACAACCGACCTGGACCTGCACGGATCAGACGTTGATAGATAGTACCAATGCAACCTCAAGTTAGCAGCCTTGCACATCTAGACATATAGACATATCCGCTTTGATCTCTGCA

Full Affymetrix probeset data:

Annotations for 1623531_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720