FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623535_at:

>probe:Drosophila_2:1623535_at:509:297; Interrogation_Position=496; Antisense; CGCATCAAGGGTGGCGGCAACTCTT
>probe:Drosophila_2:1623535_at:231:289; Interrogation_Position=510; Antisense; CGGCAACTCTTCGAAGGCGGACAGT
>probe:Drosophila_2:1623535_at:346:401; Interrogation_Position=529; Antisense; GACAGTGGCCATGGCATTGCCATCA
>probe:Drosophila_2:1623535_at:549:581; Interrogation_Position=560; Antisense; TGGCGAAGGTCAAGGCCTGCATCAA
>probe:Drosophila_2:1623535_at:38:215; Interrogation_Position=595; Antisense; AAGAGATCGCGTGGCTTTGAGCAGC
>probe:Drosophila_2:1623535_at:56:521; Interrogation_Position=605; Antisense; GTGGCTTTGAGCAGCACAATCGCAT
>probe:Drosophila_2:1623535_at:41:163; Interrogation_Position=620; Antisense; ACAATCGCATCCGTGAAGTCATCCA
>probe:Drosophila_2:1623535_at:448:119; Interrogation_Position=686; Antisense; AGCTGCAAAGCGATCGACACACCAT
>probe:Drosophila_2:1623535_at:413:369; Interrogation_Position=728; Antisense; GAATGCGTGCCGATCTGGACAGGAT
>probe:Drosophila_2:1623535_at:261:71; Interrogation_Position=821; Antisense; AGGCGAGTCTCAGGAAGTCGACCGC
>probe:Drosophila_2:1623535_at:10:205; Interrogation_Position=853; Antisense; AAGCCGACGCAAAACATGGTGACCT
>probe:Drosophila_2:1623535_at:102:45; Interrogation_Position=884; Antisense; ATCGCCGCTCGGGTGGCAAACGAAA
>probe:Drosophila_2:1623535_at:178:413; Interrogation_Position=915; Antisense; GACCGTTGCCATTCCGATGAACCGG
>probe:Drosophila_2:1623535_at:154:171; Interrogation_Position=941; Antisense; AAAGTGTGCTGACCAACAAGGCCCC

Paste this into a BLAST search page for me
CGCATCAAGGGTGGCGGCAACTCTTCGGCAACTCTTCGAAGGCGGACAGTGACAGTGGCCATGGCATTGCCATCATGGCGAAGGTCAAGGCCTGCATCAAAAGAGATCGCGTGGCTTTGAGCAGCGTGGCTTTGAGCAGCACAATCGCATACAATCGCATCCGTGAAGTCATCCAAGCTGCAAAGCGATCGACACACCATGAATGCGTGCCGATCTGGACAGGATAGGCGAGTCTCAGGAAGTCGACCGCAAGCCGACGCAAAACATGGTGACCTATCGCCGCTCGGGTGGCAAACGAAAGACCGTTGCCATTCCGATGAACCGGAAAGTGTGCTGACCAACAAGGCCCC

Full Affymetrix probeset data:

Annotations for 1623535_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720