Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623539_at:

>probe:Drosophila_2:1623539_at:368:363; Interrogation_Position=150; Antisense; GAAAATTTTCCGCTTCCAAGTGTAG
>probe:Drosophila_2:1623539_at:413:485; Interrogation_Position=171; Antisense; GTAGAAACACAAGCCGCAACTGATG
>probe:Drosophila_2:1623539_at:444:371; Interrogation_Position=195; Antisense; GAAGGAGGTCCTCCATTACCGCAAT
>probe:Drosophila_2:1623539_at:400:707; Interrogation_Position=210; Antisense; TTACCGCAATCACCTGAAAACGTTG
>probe:Drosophila_2:1623539_at:222:215; Interrogation_Position=256; Antisense; AAGAGGTTCAAGAGTCCCAGCGCTG
>probe:Drosophila_2:1623539_at:431:309; Interrogation_Position=272; Antisense; CCAGCGCTGCAGTAGTTCGAGGATT
>probe:Drosophila_2:1623539_at:230:173; Interrogation_Position=385; Antisense; AAAGCACTCTTTACGGAGATCGCGC
>probe:Drosophila_2:1623539_at:476:427; Interrogation_Position=400; Antisense; GAGATCGCGCTGTGAACTGTACCAA
>probe:Drosophila_2:1623539_at:363:195; Interrogation_Position=414; Antisense; AACTGTACCAAGTGCGGAACTGTCA
>probe:Drosophila_2:1623539_at:380:377; Interrogation_Position=430; Antisense; GAACTGTCACGATCTATTTTCCGGC
>probe:Drosophila_2:1623539_at:5:261; Interrogation_Position=458; Antisense; CACCAAGTTTTTCTCATGTGCCGAG
>probe:Drosophila_2:1623539_at:40:81; Interrogation_Position=502; Antisense; AGGTGAAACGGATCTCGTCCAGAAA
>probe:Drosophila_2:1623539_at:129:219; Interrogation_Position=526; Antisense; AAGTACTTGGTGGTGCTTACCGCAA
>probe:Drosophila_2:1623539_at:632:359; Interrogation_Position=547; Antisense; GCAAGCAACCTATGAAGCGTTCGAA

Paste this into a BLAST search page for me
GAAAATTTTCCGCTTCCAAGTGTAGGTAGAAACACAAGCCGCAACTGATGGAAGGAGGTCCTCCATTACCGCAATTTACCGCAATCACCTGAAAACGTTGAAGAGGTTCAAGAGTCCCAGCGCTGCCAGCGCTGCAGTAGTTCGAGGATTAAAGCACTCTTTACGGAGATCGCGCGAGATCGCGCTGTGAACTGTACCAAAACTGTACCAAGTGCGGAACTGTCAGAACTGTCACGATCTATTTTCCGGCCACCAAGTTTTTCTCATGTGCCGAGAGGTGAAACGGATCTCGTCCAGAAAAAGTACTTGGTGGTGCTTACCGCAAGCAAGCAACCTATGAAGCGTTCGAA

Full Affymetrix probeset data:

Annotations for 1623539_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime