Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623540_at:

>probe:Drosophila_2:1623540_at:241:59; Interrogation_Position=110; Antisense; ATGATCCTGTGTGCGGATCGGACTC
>probe:Drosophila_2:1623540_at:294:451; Interrogation_Position=125; Antisense; GATCGGACTCCGTGACCTATAGTAA
>probe:Drosophila_2:1623540_at:347:51; Interrogation_Position=13; Antisense; ATGCGTTGCCTAGCCTTCATCGCTT
>probe:Drosophila_2:1623540_at:674:289; Interrogation_Position=135; Antisense; CGTGACCTATAGTAACCAGTGTGTT
>probe:Drosophila_2:1623540_at:123:267; Interrogation_Position=151; Antisense; CAGTGTGTTTTGGATTGTTTAATTA
>probe:Drosophila_2:1623540_at:595:167; Interrogation_Position=175; Antisense; AAAGAAGGACGCTCCATTACCGTGG
>probe:Drosophila_2:1623540_at:507:555; Interrogation_Position=181; Antisense; GGACGCTCCATTACCGTGGAGAAGA
>probe:Drosophila_2:1623540_at:68:675; Interrogation_Position=23; Antisense; TAGCCTTCATCGCTTTCTGTCTGTC
>probe:Drosophila_2:1623540_at:16:717; Interrogation_Position=37; Antisense; TTCTGTCTGTCTGCTCTTTTGGCCA
>probe:Drosophila_2:1623540_at:555:499; Interrogation_Position=45; Antisense; GTCTGCTCTTTTGGCCATGGCTGTG
>probe:Drosophila_2:1623540_at:640:573; Interrogation_Position=63; Antisense; GGCTGTGGGCCAGGTATTCCAGTAC
>probe:Drosophila_2:1623540_at:386:79; Interrogation_Position=74; Antisense; AGGTATTCCAGTACTCCTGCCCGTG
>probe:Drosophila_2:1623540_at:387:281; Interrogation_Position=90; Antisense; CTGCCCGTGTCCTCGAAACTATGAT
>probe:Drosophila_2:1623540_at:435:515; Interrogation_Position=96; Antisense; GTGTCCTCGAAACTATGATCCTGTG

Paste this into a BLAST search page for me
ATGATCCTGTGTGCGGATCGGACTCGATCGGACTCCGTGACCTATAGTAAATGCGTTGCCTAGCCTTCATCGCTTCGTGACCTATAGTAACCAGTGTGTTCAGTGTGTTTTGGATTGTTTAATTAAAAGAAGGACGCTCCATTACCGTGGGGACGCTCCATTACCGTGGAGAAGATAGCCTTCATCGCTTTCTGTCTGTCTTCTGTCTGTCTGCTCTTTTGGCCAGTCTGCTCTTTTGGCCATGGCTGTGGGCTGTGGGCCAGGTATTCCAGTACAGGTATTCCAGTACTCCTGCCCGTGCTGCCCGTGTCCTCGAAACTATGATGTGTCCTCGAAACTATGATCCTGTG

Full Affymetrix probeset data:

Annotations for 1623540_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime