FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623542_at:

>probe:Drosophila_2:1623542_at:429:261; Interrogation_Position=142; Antisense; CACCAGCAGGAGCAAACCCACAGGA
>probe:Drosophila_2:1623542_at:20:553; Interrogation_Position=150; Antisense; GGAGCAAACCCACAGGAACTGGAGT
>probe:Drosophila_2:1623542_at:32:143; Interrogation_Position=167; Antisense; ACTGGAGTGGTTCGACCACCATTGC
>probe:Drosophila_2:1623542_at:339:25; Interrogation_Position=18; Antisense; ATAGTCTCAGACAATTTTCGTAACG
>probe:Drosophila_2:1623542_at:406:309; Interrogation_Position=182; Antisense; CCACCATTGCCAAATGCACACGATA
>probe:Drosophila_2:1623542_at:409:357; Interrogation_Position=197; Antisense; GCACACGATAGGATTTGGAAGATTA
>probe:Drosophila_2:1623542_at:555:689; Interrogation_Position=246; Antisense; TATTCGGTCCCCAAATTGGATCCAC
>probe:Drosophila_2:1623542_at:491:105; Interrogation_Position=26; Antisense; AGACAATTTTCGTAACGCGCCGCTA
>probe:Drosophila_2:1623542_at:690:447; Interrogation_Position=264; Antisense; GATCCACGTTTTAAATCCTGATATT
>probe:Drosophila_2:1623542_at:6:463; Interrogation_Position=309; Antisense; GATTCTTTGACGTCTAAAGCGCTGA
>probe:Drosophila_2:1623542_at:109:661; Interrogation_Position=38; Antisense; TAACGCGCCGCTAAAATGCCCGAAA
>probe:Drosophila_2:1623542_at:185:339; Interrogation_Position=47; Antisense; GCTAAAATGCCCGAAAAACCATCAG
>probe:Drosophila_2:1623542_at:409:171; Interrogation_Position=62; Antisense; AAACCATCAGCAAAGTCGGCTCCGA
>probe:Drosophila_2:1623542_at:474:357; Interrogation_Position=71; Antisense; GCAAAGTCGGCTCCGAGGCCCCTGA

Paste this into a BLAST search page for me
CACCAGCAGGAGCAAACCCACAGGAGGAGCAAACCCACAGGAACTGGAGTACTGGAGTGGTTCGACCACCATTGCATAGTCTCAGACAATTTTCGTAACGCCACCATTGCCAAATGCACACGATAGCACACGATAGGATTTGGAAGATTATATTCGGTCCCCAAATTGGATCCACAGACAATTTTCGTAACGCGCCGCTAGATCCACGTTTTAAATCCTGATATTGATTCTTTGACGTCTAAAGCGCTGATAACGCGCCGCTAAAATGCCCGAAAGCTAAAATGCCCGAAAAACCATCAGAAACCATCAGCAAAGTCGGCTCCGAGCAAAGTCGGCTCCGAGGCCCCTGA

Full Affymetrix probeset data:

Annotations for 1623542_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720