Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623543_at:

>probe:Drosophila_2:1623543_at:377:667; Interrogation_Position=2294; Antisense; TACAGACAGAGTCCTCACAGTGCAC
>probe:Drosophila_2:1623543_at:139:129; Interrogation_Position=2317; Antisense; ACCAGCATATCACTGTGGTGCCAGT
>probe:Drosophila_2:1623543_at:563:491; Interrogation_Position=2340; Antisense; GTAAACACAGAACAATGGCACTCGT
>probe:Drosophila_2:1623543_at:514:567; Interrogation_Position=2356; Antisense; GGCACTCGTGTACCATGATATTCGC
>probe:Drosophila_2:1623543_at:304:59; Interrogation_Position=2370; Antisense; ATGATATTCGCAGAAATCTCGCCAA
>probe:Drosophila_2:1623543_at:347:395; Interrogation_Position=2382; Antisense; GAAATCTCGCCAATAACTAGCATGT
>probe:Drosophila_2:1623543_at:109:31; Interrogation_Position=2431; Antisense; ATAAGCCGCAGTCAATTTGCAGTAG
>probe:Drosophila_2:1623543_at:91:361; Interrogation_Position=2466; Antisense; GAATTTCGTTTCTTGTCGTTCAGAG
>probe:Drosophila_2:1623543_at:587:477; Interrogation_Position=2510; Antisense; GTTTTTCGCTATTTATCCACGTATA
>probe:Drosophila_2:1623543_at:58:187; Interrogation_Position=2559; Antisense; AACAATGTTCCTTAAGCAGCGAAAC
>probe:Drosophila_2:1623543_at:68:175; Interrogation_Position=2580; Antisense; AAACGATGAGGCGTGTTCATTTCAT
>probe:Drosophila_2:1623543_at:564:471; Interrogation_Position=2594; Antisense; GTTCATTTCATTTTACGGCATACTC
>probe:Drosophila_2:1623543_at:301:567; Interrogation_Position=2610; Antisense; GGCATACTCAAATCTGTAACCCAAT
>probe:Drosophila_2:1623543_at:194:711; Interrogation_Position=2636; Antisense; TTCACACAATCACACACTAACAAGC

Paste this into a BLAST search page for me
TACAGACAGAGTCCTCACAGTGCACACCAGCATATCACTGTGGTGCCAGTGTAAACACAGAACAATGGCACTCGTGGCACTCGTGTACCATGATATTCGCATGATATTCGCAGAAATCTCGCCAAGAAATCTCGCCAATAACTAGCATGTATAAGCCGCAGTCAATTTGCAGTAGGAATTTCGTTTCTTGTCGTTCAGAGGTTTTTCGCTATTTATCCACGTATAAACAATGTTCCTTAAGCAGCGAAACAAACGATGAGGCGTGTTCATTTCATGTTCATTTCATTTTACGGCATACTCGGCATACTCAAATCTGTAACCCAATTTCACACAATCACACACTAACAAGC

Full Affymetrix probeset data:

Annotations for 1623543_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime