FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623545_at:

>probe:Drosophila_2:1623545_at:344:607; Interrogation_Position=501; Antisense; TGATGAACCTCGACCAGGAGCACCT
>probe:Drosophila_2:1623545_at:264:113; Interrogation_Position=519; Antisense; AGCACCTGGGCATACCGGAGACAGA
>probe:Drosophila_2:1623545_at:66:425; Interrogation_Position=536; Antisense; GAGACAGACTTCTCGTGCGTGGTCC
>probe:Drosophila_2:1623545_at:252:123; Interrogation_Position=611; Antisense; AGCGAATCCGTTGTGATCTGCTGCA
>probe:Drosophila_2:1623545_at:71:639; Interrogation_Position=627; Antisense; TCTGCTGCACCAAGGAGGGCGTCAA
>probe:Drosophila_2:1623545_at:537:517; Interrogation_Position=671; Antisense; GTGGGCACCGCCAACATTAAGCTAG
>probe:Drosophila_2:1623545_at:586:175; Interrogation_Position=699; Antisense; AAACCGGCTCTGTCGACAAGGAGGA
>probe:Drosophila_2:1623545_at:443:53; Interrogation_Position=743; Antisense; ATGCAGGAGCCGGTGACGCTGACAT
>probe:Drosophila_2:1623545_at:405:611; Interrogation_Position=762; Antisense; TGACATTTGCCTGTCGCTACCTGAA
>probe:Drosophila_2:1623545_at:327:85; Interrogation_Position=820; Antisense; AGTGCAGCTGTCGATGTGCGCAGAT
>probe:Drosophila_2:1623545_at:178:99; Interrogation_Position=841; Antisense; AGATGTTCCGCTGGTAGTCGAGTAT
>probe:Drosophila_2:1623545_at:551:543; Interrogation_Position=874; Antisense; GGATCTGGGTCACATTCGCTACTAC
>probe:Drosophila_2:1623545_at:306:219; Interrogation_Position=930; Antisense; AAGTCAGCTGTGTTCCTCATATTTA
>probe:Drosophila_2:1623545_at:22:155; Interrogation_Position=984; Antisense; CACGTTCACTTCATTCCTAACTTTT

Paste this into a BLAST search page for me
TGATGAACCTCGACCAGGAGCACCTAGCACCTGGGCATACCGGAGACAGAGAGACAGACTTCTCGTGCGTGGTCCAGCGAATCCGTTGTGATCTGCTGCATCTGCTGCACCAAGGAGGGCGTCAAGTGGGCACCGCCAACATTAAGCTAGAAACCGGCTCTGTCGACAAGGAGGAATGCAGGAGCCGGTGACGCTGACATTGACATTTGCCTGTCGCTACCTGAAAGTGCAGCTGTCGATGTGCGCAGATAGATGTTCCGCTGGTAGTCGAGTATGGATCTGGGTCACATTCGCTACTACAAGTCAGCTGTGTTCCTCATATTTACACGTTCACTTCATTCCTAACTTTT

Full Affymetrix probeset data:

Annotations for 1623545_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720