Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623546_at:

>probe:Drosophila_2:1623546_at:319:563; Interrogation_Position=1001; Antisense; GGAACCATGCCCAGCAGGAGTCTGG
>probe:Drosophila_2:1623546_at:392:75; Interrogation_Position=1016; Antisense; AGGAGTCTGGCCACCACGGCGCCAA
>probe:Drosophila_2:1623546_at:104:321; Interrogation_Position=1051; Antisense; GCCCTCCACTCTAGAGATAACCAAA
>probe:Drosophila_2:1623546_at:668:483; Interrogation_Position=1090; Antisense; GTAGCAGGCGTTTTTAATTATGGTT
>probe:Drosophila_2:1623546_at:296:481; Interrogation_Position=1250; Antisense; GTATAGGGCCAATTTCCTCAAAATG
>probe:Drosophila_2:1623546_at:301:65; Interrogation_Position=1314; Antisense; ATGGGTACTCCAGCAACGATCTGTG
>probe:Drosophila_2:1623546_at:51:45; Interrogation_Position=786; Antisense; ATCGCACAGAAGATGAGCCCAGCAA
>probe:Drosophila_2:1623546_at:280:109; Interrogation_Position=873; Antisense; AGAAGCCCGAGCTGGATATCAAGCC
>probe:Drosophila_2:1623546_at:407:457; Interrogation_Position=887; Antisense; GATATCAAGCCCAATTCCAACACAA
>probe:Drosophila_2:1623546_at:7:239; Interrogation_Position=899; Antisense; AATTCCAACACAAACAAGGCCATTT
>probe:Drosophila_2:1623546_at:217:421; Interrogation_Position=926; Antisense; GAGAACCCCAACATCGATAATCCCT
>probe:Drosophila_2:1623546_at:361:455; Interrogation_Position=941; Antisense; GATAATCCCTATTTGCGGGCGGCTA
>probe:Drosophila_2:1623546_at:356:667; Interrogation_Position=964; Antisense; TACTCTGCCCAAGCGATCCAAAAAT
>probe:Drosophila_2:1623546_at:571:205; Interrogation_Position=974; Antisense; AAGCGATCCAAAAATTGCCCCACAC

Paste this into a BLAST search page for me
GGAACCATGCCCAGCAGGAGTCTGGAGGAGTCTGGCCACCACGGCGCCAAGCCCTCCACTCTAGAGATAACCAAAGTAGCAGGCGTTTTTAATTATGGTTGTATAGGGCCAATTTCCTCAAAATGATGGGTACTCCAGCAACGATCTGTGATCGCACAGAAGATGAGCCCAGCAAAGAAGCCCGAGCTGGATATCAAGCCGATATCAAGCCCAATTCCAACACAAAATTCCAACACAAACAAGGCCATTTGAGAACCCCAACATCGATAATCCCTGATAATCCCTATTTGCGGGCGGCTATACTCTGCCCAAGCGATCCAAAAATAAGCGATCCAAAAATTGCCCCACAC

Full Affymetrix probeset data:

Annotations for 1623546_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime