FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623547_at:

>probe:Drosophila_2:1623547_at:730:319; Interrogation_Position=2233; Antisense; GCCCAACTGGGACCATATGACGAAT
>probe:Drosophila_2:1623547_at:376:611; Interrogation_Position=2250; Antisense; TGACGAATCCATTCTGTCCGAGGAC
>probe:Drosophila_2:1623547_at:659:319; Interrogation_Position=2280; Antisense; GCCCGCAGAAACAACGCATCATGGA
>probe:Drosophila_2:1623547_at:708:209; Interrogation_Position=2377; Antisense; AAGCAATCGACGCTGCTGATACTCG
>probe:Drosophila_2:1623547_at:636:29; Interrogation_Position=2395; Antisense; ATACTCGCCGCCGTCGTGGTGATAG
>probe:Drosophila_2:1623547_at:556:25; Interrogation_Position=2416; Antisense; ATAGGCGCCGTCGTGGTGACGTCAA
>probe:Drosophila_2:1623547_at:91:611; Interrogation_Position=2432; Antisense; TGACGTCAATTATCGTGGCCGGCAT
>probe:Drosophila_2:1623547_at:701:345; Interrogation_Position=2453; Antisense; GCATCGTCGTGGTCTGCCGGCACAG
>probe:Drosophila_2:1623547_at:99:327; Interrogation_Position=2524; Antisense; GCGAGAAACGATGTGCCGAGCATGT
>probe:Drosophila_2:1623547_at:618:37; Interrogation_Position=2725; Antisense; ATCTCCGAGAGCTTCATCCAGTACG
>probe:Drosophila_2:1623547_at:358:261; Interrogation_Position=2757; Antisense; CAGCCTAAACGACCCGGATCTGATA
>probe:Drosophila_2:1623547_at:209:545; Interrogation_Position=2772; Antisense; GGATCTGATATTGCCGCGCGGCGAA
>probe:Drosophila_2:1623547_at:19:627; Interrogation_Position=2783; Antisense; TGCCGCGCGGCGAATTGGAATTTAC
>probe:Drosophila_2:1623547_at:134:365; Interrogation_Position=2800; Antisense; GAATTTACGACCCTGGATCCAACGC

Paste this into a BLAST search page for me
GCCCAACTGGGACCATATGACGAATTGACGAATCCATTCTGTCCGAGGACGCCCGCAGAAACAACGCATCATGGAAAGCAATCGACGCTGCTGATACTCGATACTCGCCGCCGTCGTGGTGATAGATAGGCGCCGTCGTGGTGACGTCAATGACGTCAATTATCGTGGCCGGCATGCATCGTCGTGGTCTGCCGGCACAGGCGAGAAACGATGTGCCGAGCATGTATCTCCGAGAGCTTCATCCAGTACGCAGCCTAAACGACCCGGATCTGATAGGATCTGATATTGCCGCGCGGCGAATGCCGCGCGGCGAATTGGAATTTACGAATTTACGACCCTGGATCCAACGC

Full Affymetrix probeset data:

Annotations for 1623547_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720