Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623548_at:

>probe:Drosophila_2:1623548_at:330:287; Interrogation_Position=127; Antisense; CTGGAGCCGCAGGAGATTGTCCCAA
>probe:Drosophila_2:1623548_at:532:465; Interrogation_Position=141; Antisense; GATTGTCCCAAATTTATCGTTCCAT
>probe:Drosophila_2:1623548_at:113:471; Interrogation_Position=159; Antisense; GTTCCATTTGTTCAGCTATCGACAG
>probe:Drosophila_2:1623548_at:186:341; Interrogation_Position=213; Antisense; GAAGTGGGCCACATCCAAGTTGGTA
>probe:Drosophila_2:1623548_at:191:539; Interrogation_Position=234; Antisense; GGTACTCACCGAAGAGCTGCTCAAA
>probe:Drosophila_2:1623548_at:505:229; Interrogation_Position=24; Antisense; AATGGATCGCAAGGTGTCCTGCTCA
>probe:Drosophila_2:1623548_at:497:407; Interrogation_Position=272; Antisense; GACTGGCAGATACCAACGAGTCCTG
>probe:Drosophila_2:1623548_at:704:137; Interrogation_Position=287; Antisense; ACGAGTCCTGGACCGATTTTGCATC
>probe:Drosophila_2:1623548_at:30:17; Interrogation_Position=302; Antisense; ATTTTGCATCCTTGTACGCGGACAA
>probe:Drosophila_2:1623548_at:172:351; Interrogation_Position=416; Antisense; GCACCATTCTGGAGTTTGCCCAGGA
>probe:Drosophila_2:1623548_at:67:615; Interrogation_Position=470; Antisense; TGAAGCGACTGAAACGACGCACCCT
>probe:Drosophila_2:1623548_at:659:97; Interrogation_Position=527; Antisense; AGATCGACTACTGGTATCCGCATAC
>probe:Drosophila_2:1623548_at:1:77; Interrogation_Position=560; Antisense; AGGAGACGGTGGACTTGGATCCTCA
>probe:Drosophila_2:1623548_at:658:407; Interrogation_Position=99; Antisense; GACGGAGGCGCCACTGAAGGAACAA

Paste this into a BLAST search page for me
CTGGAGCCGCAGGAGATTGTCCCAAGATTGTCCCAAATTTATCGTTCCATGTTCCATTTGTTCAGCTATCGACAGGAAGTGGGCCACATCCAAGTTGGTAGGTACTCACCGAAGAGCTGCTCAAAAATGGATCGCAAGGTGTCCTGCTCAGACTGGCAGATACCAACGAGTCCTGACGAGTCCTGGACCGATTTTGCATCATTTTGCATCCTTGTACGCGGACAAGCACCATTCTGGAGTTTGCCCAGGATGAAGCGACTGAAACGACGCACCCTAGATCGACTACTGGTATCCGCATACAGGAGACGGTGGACTTGGATCCTCAGACGGAGGCGCCACTGAAGGAACAA

Full Affymetrix probeset data:

Annotations for 1623548_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime