FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623549_at:

>probe:Drosophila_2:1623549_at:163:483; Interrogation_Position=3270; Antisense; GTATTTTGTATATTTCCGTGCGTGT
>probe:Drosophila_2:1623549_at:317:19; Interrogation_Position=3281; Antisense; ATTTCCGTGCGTGTGTGTCTTGTCC
>probe:Drosophila_2:1623549_at:196:303; Interrogation_Position=3311; Antisense; CCGATTTGTCCAATTTGTCCCATTG
>probe:Drosophila_2:1623549_at:574:243; Interrogation_Position=3322; Antisense; AATTTGTCCCATTGGTCCCATTTGC
>probe:Drosophila_2:1623549_at:330:21; Interrogation_Position=3359; Antisense; ATTTGGCCGCTCTGTGTGTGCTTTG
>probe:Drosophila_2:1623549_at:680:619; Interrogation_Position=3377; Antisense; TGCTTTGTGTTTGTATTGGGTGCCA
>probe:Drosophila_2:1623549_at:696:231; Interrogation_Position=3412; Antisense; AATGCAATCTCAGTGTCTCGAGCCT
>probe:Drosophila_2:1623549_at:596:293; Interrogation_Position=3430; Antisense; CGAGCCTCCATTTCGATTCCGTAAA
>probe:Drosophila_2:1623549_at:229:691; Interrogation_Position=3465; Antisense; TTTGTATTTCTAATGCTGGCACGAT
>probe:Drosophila_2:1623549_at:114:529; Interrogation_Position=3660; Antisense; GGGACTCAATCGATATCAGCGAGGA
>probe:Drosophila_2:1623549_at:730:503; Interrogation_Position=3685; Antisense; GTGGATACGAGGTCCTTTTCCAATC
>probe:Drosophila_2:1623549_at:648:701; Interrogation_Position=3700; Antisense; TTTTCCAATCCCACTATCAATGAGC
>probe:Drosophila_2:1623549_at:57:549; Interrogation_Position=3735; Antisense; GGATGTGCGTGTGTCTGATTTCAAA
>probe:Drosophila_2:1623549_at:66:235; Interrogation_Position=3815; Antisense; AATCCACGCGATTTTCGAGGGACAG

Paste this into a BLAST search page for me
GTATTTTGTATATTTCCGTGCGTGTATTTCCGTGCGTGTGTGTCTTGTCCCCGATTTGTCCAATTTGTCCCATTGAATTTGTCCCATTGGTCCCATTTGCATTTGGCCGCTCTGTGTGTGCTTTGTGCTTTGTGTTTGTATTGGGTGCCAAATGCAATCTCAGTGTCTCGAGCCTCGAGCCTCCATTTCGATTCCGTAAATTTGTATTTCTAATGCTGGCACGATGGGACTCAATCGATATCAGCGAGGAGTGGATACGAGGTCCTTTTCCAATCTTTTCCAATCCCACTATCAATGAGCGGATGTGCGTGTGTCTGATTTCAAAAATCCACGCGATTTTCGAGGGACAG

Full Affymetrix probeset data:

Annotations for 1623549_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720