Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623550_at:

>probe:Drosophila_2:1623550_at:190:387; Interrogation_Position=2340; Antisense; GAACACCCAGCTGCTGTTCGATAAG
>probe:Drosophila_2:1623550_at:665:337; Interrogation_Position=2367; Antisense; GCTAAACACCATCTCTAAGTCTTTT
>probe:Drosophila_2:1623550_at:275:487; Interrogation_Position=2402; Antisense; GTACCGTACCCAATGCTATCATGGC
>probe:Drosophila_2:1623550_at:587:685; Interrogation_Position=2418; Antisense; TATCATGGCAGCTACAGTTCTCCCA
>probe:Drosophila_2:1623550_at:614:471; Interrogation_Position=2434; Antisense; GTTCTCCCAGAACGCAATGACTTTA
>probe:Drosophila_2:1623550_at:467:225; Interrogation_Position=2449; Antisense; AATGACTTTACCTCGAATTTGATGC
>probe:Drosophila_2:1623550_at:418:49; Interrogation_Position=2470; Antisense; ATGCGGACTGTCACCAACAAGTTCA
>probe:Drosophila_2:1623550_at:713:597; Interrogation_Position=2538; Antisense; TGTGCCCCTGGGTTCATATCATCAG
>probe:Drosophila_2:1623550_at:542:577; Interrogation_Position=2613; Antisense; GGCCCACAGCTACGGCTATAATCTG
>probe:Drosophila_2:1623550_at:655:655; Interrogation_Position=2631; Antisense; TAATCTGTTTGATGCCAAGCCAAGG
>probe:Drosophila_2:1623550_at:543:203; Interrogation_Position=2647; Antisense; AAGCCAAGGCCCAAGTTTCACGGAG
>probe:Drosophila_2:1623550_at:249:439; Interrogation_Position=2669; Antisense; GAGGCACAGTCAAGCGATCCGCAGG
>probe:Drosophila_2:1623550_at:156:163; Interrogation_Position=2697; Antisense; AAATTCAGCCTACTTTGGATCCCTT
>probe:Drosophila_2:1623550_at:193:403; Interrogation_Position=2752; Antisense; GACTTTGCCGTTACCCAGGAGAGGG

Paste this into a BLAST search page for me
GAACACCCAGCTGCTGTTCGATAAGGCTAAACACCATCTCTAAGTCTTTTGTACCGTACCCAATGCTATCATGGCTATCATGGCAGCTACAGTTCTCCCAGTTCTCCCAGAACGCAATGACTTTAAATGACTTTACCTCGAATTTGATGCATGCGGACTGTCACCAACAAGTTCATGTGCCCCTGGGTTCATATCATCAGGGCCCACAGCTACGGCTATAATCTGTAATCTGTTTGATGCCAAGCCAAGGAAGCCAAGGCCCAAGTTTCACGGAGGAGGCACAGTCAAGCGATCCGCAGGAAATTCAGCCTACTTTGGATCCCTTGACTTTGCCGTTACCCAGGAGAGGG

Full Affymetrix probeset data:

Annotations for 1623550_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime