FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623551_at:

>probe:Drosophila_2:1623551_at:482:55; Interrogation_Position=414; Antisense; ATGACATGCCCGATGAGCTGAAGGA
>probe:Drosophila_2:1623551_at:203:611; Interrogation_Position=446; Antisense; TGACCGATGTGGCTGCGTGCATATA
>probe:Drosophila_2:1623551_at:390:197; Interrogation_Position=492; Antisense; AATCGACGAATTTCCTACCAGTACG
>probe:Drosophila_2:1623551_at:201:249; Interrogation_Position=529; Antisense; CAATAACTTTACAACAGCCCCGACA
>probe:Drosophila_2:1623551_at:550:549; Interrogation_Position=584; Antisense; GGAGGGCGCGTAAAGTTAGAACATA
>probe:Drosophila_2:1623551_at:496:25; Interrogation_Position=606; Antisense; ATAGTTTCCAAAGCTAAGGGCCCAG
>probe:Drosophila_2:1623551_at:383:219; Interrogation_Position=621; Antisense; AAGGGCCCAGCTGAATTTTTTATAT
>probe:Drosophila_2:1623551_at:562:257; Interrogation_Position=647; Antisense; CACACTGCTGACTTTTGGTTTATAC
>probe:Drosophila_2:1623551_at:486:67; Interrogation_Position=688; Antisense; ATGGCTACCACAACAATACAAAGAA
>probe:Drosophila_2:1623551_at:52:653; Interrogation_Position=757; Antisense; TTCCCTGAAAGGCAACTAGCAATTT
>probe:Drosophila_2:1623551_at:686:57; Interrogation_Position=797; Antisense; CTTGTGCTTTGTCTTTGATTTGGTC
>probe:Drosophila_2:1623551_at:425:591; Interrogation_Position=817; Antisense; TGGTCTATTATGAACAACGATGCTG
>probe:Drosophila_2:1623551_at:357:199; Interrogation_Position=832; Antisense; AACGATGCTGACAATGTCGTAGTTT
>probe:Drosophila_2:1623551_at:508:621; Interrogation_Position=962; Antisense; TGCTGCAGAAGCATTGTCTAATCTT

Paste this into a BLAST search page for me
ATGACATGCCCGATGAGCTGAAGGATGACCGATGTGGCTGCGTGCATATAAATCGACGAATTTCCTACCAGTACGCAATAACTTTACAACAGCCCCGACAGGAGGGCGCGTAAAGTTAGAACATAATAGTTTCCAAAGCTAAGGGCCCAGAAGGGCCCAGCTGAATTTTTTATATCACACTGCTGACTTTTGGTTTATACATGGCTACCACAACAATACAAAGAATTCCCTGAAAGGCAACTAGCAATTTCTTGTGCTTTGTCTTTGATTTGGTCTGGTCTATTATGAACAACGATGCTGAACGATGCTGACAATGTCGTAGTTTTGCTGCAGAAGCATTGTCTAATCTT

Full Affymetrix probeset data:

Annotations for 1623551_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720