Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623554_at:

>probe:Drosophila_2:1623554_at:289:583; Interrogation_Position=1477; Antisense; TGGCTTACGACCAGGACAGCTACAT
>probe:Drosophila_2:1623554_at:571:667; Interrogation_Position=1497; Antisense; TACATGGTCATCTTTCAGTTTCGGC
>probe:Drosophila_2:1623554_at:564:287; Interrogation_Position=1591; Antisense; CGGAGTATCCCTTTCTGTTCGAAGG
>probe:Drosophila_2:1623554_at:727:677; Interrogation_Position=1624; Antisense; TAGTTCGTTGCGAAGGCTGCCACAT
>probe:Drosophila_2:1623554_at:40:251; Interrogation_Position=1667; Antisense; CAATCTCACTCTCCAAACGGTGGAA
>probe:Drosophila_2:1623554_at:527:225; Interrogation_Position=1700; Antisense; AAGGAACAGAGCACACCGAGTCACC
>probe:Drosophila_2:1623554_at:153:431; Interrogation_Position=1717; Antisense; GAGTCACCAAGGTCATGCCTCGGGA
>probe:Drosophila_2:1623554_at:386:587; Interrogation_Position=1777; Antisense; TGGACCTGTCGCTCGCGGATGAAAA
>probe:Drosophila_2:1623554_at:196:207; Interrogation_Position=1806; Antisense; AAGCTGATCCTTGGCAACGATTTCG
>probe:Drosophila_2:1623554_at:163:139; Interrogation_Position=1822; Antisense; ACGATTTCGAAGTGGGCTTCCTGCT
>probe:Drosophila_2:1623554_at:321:227; Interrogation_Position=1866; Antisense; AAGGCGGTGCTCTTTTACACGGGCG
>probe:Drosophila_2:1623554_at:158:707; Interrogation_Position=1880; Antisense; TTACACGGGCGACCTAGTTGACAGC
>probe:Drosophila_2:1623554_at:502:507; Interrogation_Position=1971; Antisense; GTGCGACGCGACTAGCTGTTTGCTA
>probe:Drosophila_2:1623554_at:112:161; Interrogation_Position=2035; Antisense; AAATTCTACAGTTCGGCCAAAGCCA

Paste this into a BLAST search page for me
TGGCTTACGACCAGGACAGCTACATTACATGGTCATCTTTCAGTTTCGGCCGGAGTATCCCTTTCTGTTCGAAGGTAGTTCGTTGCGAAGGCTGCCACATCAATCTCACTCTCCAAACGGTGGAAAAGGAACAGAGCACACCGAGTCACCGAGTCACCAAGGTCATGCCTCGGGATGGACCTGTCGCTCGCGGATGAAAAAAGCTGATCCTTGGCAACGATTTCGACGATTTCGAAGTGGGCTTCCTGCTAAGGCGGTGCTCTTTTACACGGGCGTTACACGGGCGACCTAGTTGACAGCGTGCGACGCGACTAGCTGTTTGCTAAAATTCTACAGTTCGGCCAAAGCCA

Full Affymetrix probeset data:

Annotations for 1623554_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime