FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623555_at:

>probe:Drosophila_2:1623555_at:377:655; Interrogation_Position=1020; Antisense; TAATGGCCCGGCGTAGTCTTACTCT
>probe:Drosophila_2:1623555_at:428:681; Interrogation_Position=467; Antisense; TATACCCCTGGTAGAGATTGTCCCA
>probe:Drosophila_2:1623555_at:255:585; Interrogation_Position=517; Antisense; TGGAGCGAACCCGTGACCTAATGCT
>probe:Drosophila_2:1623555_at:723:211; Interrogation_Position=572; Antisense; AAGAGAGATTCAGGGCTTCGCCACC
>probe:Drosophila_2:1623555_at:725:261; Interrogation_Position=593; Antisense; CACCAATCGGATTCAGTATGCCATT
>probe:Drosophila_2:1623555_at:111:443; Interrogation_Position=666; Antisense; GATGTGGATCGAGTTCTCAGCCAGG
>probe:Drosophila_2:1623555_at:100:281; Interrogation_Position=681; Antisense; CTCAGCCAGGGCTTGGGATTGCGAT
>probe:Drosophila_2:1623555_at:646:541; Interrogation_Position=696; Antisense; GGATTGCGATATGCCCTGCTAGGAT
>probe:Drosophila_2:1623555_at:561:423; Interrogation_Position=726; Antisense; GAGACAGCCCATCTGAATGCGCCTG
>probe:Drosophila_2:1623555_at:152:583; Interrogation_Position=761; Antisense; TGACTACTTCCAGCGTTTTGGTGGG
>probe:Drosophila_2:1623555_at:480:165; Interrogation_Position=787; Antisense; AAATCTCTGCGGTGAGTGCCACCTA
>probe:Drosophila_2:1623555_at:165:73; Interrogation_Position=815; Antisense; AGAGACCCCGAATACCCAGGAGGAT
>probe:Drosophila_2:1623555_at:550:521; Interrogation_Position=910; Antisense; GGGCCGTTCGTGATGAATTCCTCAT
>probe:Drosophila_2:1623555_at:104:337; Interrogation_Position=979; Antisense; GCTGCGTTTGTGATGTTCGCTGAAT

Paste this into a BLAST search page for me
TAATGGCCCGGCGTAGTCTTACTCTTATACCCCTGGTAGAGATTGTCCCATGGAGCGAACCCGTGACCTAATGCTAAGAGAGATTCAGGGCTTCGCCACCCACCAATCGGATTCAGTATGCCATTGATGTGGATCGAGTTCTCAGCCAGGCTCAGCCAGGGCTTGGGATTGCGATGGATTGCGATATGCCCTGCTAGGATGAGACAGCCCATCTGAATGCGCCTGTGACTACTTCCAGCGTTTTGGTGGGAAATCTCTGCGGTGAGTGCCACCTAAGAGACCCCGAATACCCAGGAGGATGGGCCGTTCGTGATGAATTCCTCATGCTGCGTTTGTGATGTTCGCTGAAT

Full Affymetrix probeset data:

Annotations for 1623555_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720