FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623556_at:

>probe:Drosophila_2:1623556_at:522:567; Interrogation_Position=1407; Antisense; GGCACTGTCAATCTTCGGCATCATT
>probe:Drosophila_2:1623556_at:626:23; Interrogation_Position=1513; Antisense; ATATCGCTGGCGTTCTGCTTTTGGA
>probe:Drosophila_2:1623556_at:214:133; Interrogation_Position=1560; Antisense; ACCGCTGGTCAGCTTGGATATGTCC
>probe:Drosophila_2:1623556_at:13:25; Interrogation_Position=1577; Antisense; ATATGTCCACGGCTGGATGTCCGGT
>probe:Drosophila_2:1623556_at:596:519; Interrogation_Position=1600; Antisense; GTGGACAGGAGCTTTGCCCGCGACA
>probe:Drosophila_2:1623556_at:604:325; Interrogation_Position=1619; Antisense; GCGACATTTTCCTCAAGACTGTGAT
>probe:Drosophila_2:1623556_at:411:419; Interrogation_Position=1660; Antisense; GAGCATTACTTTTACCTGTACAGGA
>probe:Drosophila_2:1623556_at:646:279; Interrogation_Position=1689; Antisense; CTACATGTGGTACGCTGCTTTGGGC
>probe:Drosophila_2:1623556_at:323:617; Interrogation_Position=1704; Antisense; TGCTTTGGGCTTCCTGATAACCTTC
>probe:Drosophila_2:1623556_at:431:31; Interrogation_Position=1720; Antisense; ATAACCTTCTTTGGCGGATGGCTGT
>probe:Drosophila_2:1623556_at:554:673; Interrogation_Position=1792; Antisense; TACCAGGATGCGGACTGCACGCTAA
>probe:Drosophila_2:1623556_at:100:135; Interrogation_Position=1810; Antisense; ACGCTAATCAAGCACGATCTCTTCG
>probe:Drosophila_2:1623556_at:607:317; Interrogation_Position=1836; Antisense; GCCGCCGATAGCCAAACGTTTGCAA
>probe:Drosophila_2:1623556_at:648:427; Interrogation_Position=1903; Antisense; GAGATTGGCGGCATCACGACAGAGA

Paste this into a BLAST search page for me
GGCACTGTCAATCTTCGGCATCATTATATCGCTGGCGTTCTGCTTTTGGAACCGCTGGTCAGCTTGGATATGTCCATATGTCCACGGCTGGATGTCCGGTGTGGACAGGAGCTTTGCCCGCGACAGCGACATTTTCCTCAAGACTGTGATGAGCATTACTTTTACCTGTACAGGACTACATGTGGTACGCTGCTTTGGGCTGCTTTGGGCTTCCTGATAACCTTCATAACCTTCTTTGGCGGATGGCTGTTACCAGGATGCGGACTGCACGCTAAACGCTAATCAAGCACGATCTCTTCGGCCGCCGATAGCCAAACGTTTGCAAGAGATTGGCGGCATCACGACAGAGA

Full Affymetrix probeset data:

Annotations for 1623556_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720