FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623557_at:

>probe:Drosophila_2:1623557_at:337:557; Interrogation_Position=1007; Antisense; GGAAATTTCTGAGCCTTTGGTAACA
>probe:Drosophila_2:1623557_at:611:353; Interrogation_Position=532; Antisense; GCACCATGAATCTTCGCTACAATGA
>probe:Drosophila_2:1623557_at:532:681; Interrogation_Position=561; Antisense; TATGTGCTGAGCTGCGGTTCGATGA
>probe:Drosophila_2:1623557_at:620:421; Interrogation_Position=627; Antisense; GAGAACTACGTGTCCAGCATGGCCA
>probe:Drosophila_2:1623557_at:572:75; Interrogation_Position=652; Antisense; AGGAGTTTGGCTCAGTGTACGCCTA
>probe:Drosophila_2:1623557_at:231:601; Interrogation_Position=667; Antisense; TGTACGCCTACACTGGGCCGATATA
>probe:Drosophila_2:1623557_at:88:459; Interrogation_Position=686; Antisense; GATATACACCCCAACATGTTACGAG
>probe:Drosophila_2:1623557_at:668:433; Interrogation_Position=735; Antisense; GAGGTGTTTGACTGGATTCCGATAC
>probe:Drosophila_2:1623557_at:225:87; Interrogation_Position=761; Antisense; AGTGCCATCCCATTTCTTTAAGGTA
>probe:Drosophila_2:1623557_at:87:547; Interrogation_Position=810; Antisense; GGATCCCAACCCTTCATGGAAGCAT
>probe:Drosophila_2:1623557_at:448:361; Interrogation_Position=865; Antisense; GCAAGTTGAATGACCACCGCGTCAA
>probe:Drosophila_2:1623557_at:67:27; Interrogation_Position=900; Antisense; ATAGAGCGTTACACAGGACTGCGAT
>probe:Drosophila_2:1623557_at:109:215; Interrogation_Position=930; Antisense; AAGATCATGCAACCCGTAGTCCAAT
>probe:Drosophila_2:1623557_at:558:225; Interrogation_Position=960; Antisense; AAGGACTCATTTACGGTGGACACCA

Paste this into a BLAST search page for me
GGAAATTTCTGAGCCTTTGGTAACAGCACCATGAATCTTCGCTACAATGATATGTGCTGAGCTGCGGTTCGATGAGAGAACTACGTGTCCAGCATGGCCAAGGAGTTTGGCTCAGTGTACGCCTATGTACGCCTACACTGGGCCGATATAGATATACACCCCAACATGTTACGAGGAGGTGTTTGACTGGATTCCGATACAGTGCCATCCCATTTCTTTAAGGTAGGATCCCAACCCTTCATGGAAGCATGCAAGTTGAATGACCACCGCGTCAAATAGAGCGTTACACAGGACTGCGATAAGATCATGCAACCCGTAGTCCAATAAGGACTCATTTACGGTGGACACCA

Full Affymetrix probeset data:

Annotations for 1623557_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720