FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623558_at:

>probe:Drosophila_2:1623558_at:43:273; Interrogation_Position=1061; Antisense; CATTTACACGTAGTCTTAGCCAAGA
>probe:Drosophila_2:1623558_at:642:435; Interrogation_Position=1093; Antisense; GAGGATTCCTCGTTGCGTCGAGAAT
>probe:Drosophila_2:1623558_at:601:443; Interrogation_Position=1143; Antisense; GATGATATTCTTTAGCCTTTAGCTG
>probe:Drosophila_2:1623558_at:499:449; Interrogation_Position=634; Antisense; GATCCCCAGACAATCACTCATAAGA
>probe:Drosophila_2:1623558_at:36:205; Interrogation_Position=662; Antisense; AAGCCAAGGGCTGTAACCTTCGCCT
>probe:Drosophila_2:1623558_at:566:713; Interrogation_Position=695; Antisense; TTCTTTGCCCACTCAGGAGGTCAAA
>probe:Drosophila_2:1623558_at:321:79; Interrogation_Position=719; Antisense; AGGTCGGCCAAATCCACTGACTGAA
>probe:Drosophila_2:1623558_at:6:255; Interrogation_Position=804; Antisense; CAACACCATGATACTGATAGCCCAG
>probe:Drosophila_2:1623558_at:214:455; Interrogation_Position=819; Antisense; GATAGCCCAGTCTGATTTCTTGCTT
>probe:Drosophila_2:1623558_at:193:605; Interrogation_Position=831; Antisense; TGATTTCTTGCTTTCTTCCAACGAA
>probe:Drosophila_2:1623558_at:256:199; Interrogation_Position=850; Antisense; AACGAACTCTACTACTCTATGCGAA
>probe:Drosophila_2:1623558_at:362:37; Interrogation_Position=874; Antisense; ATCTCTTCAGATCTTTTAGTCGCCG
>probe:Drosophila_2:1623558_at:571:703; Interrogation_Position=889; Antisense; TTAGTCGCCGGAACTCTGCCATTTT
>probe:Drosophila_2:1623558_at:111:283; Interrogation_Position=904; Antisense; CTGCCATTTTCGGACTCATGTGATA

Paste this into a BLAST search page for me
CATTTACACGTAGTCTTAGCCAAGAGAGGATTCCTCGTTGCGTCGAGAATGATGATATTCTTTAGCCTTTAGCTGGATCCCCAGACAATCACTCATAAGAAAGCCAAGGGCTGTAACCTTCGCCTTTCTTTGCCCACTCAGGAGGTCAAAAGGTCGGCCAAATCCACTGACTGAACAACACCATGATACTGATAGCCCAGGATAGCCCAGTCTGATTTCTTGCTTTGATTTCTTGCTTTCTTCCAACGAAAACGAACTCTACTACTCTATGCGAAATCTCTTCAGATCTTTTAGTCGCCGTTAGTCGCCGGAACTCTGCCATTTTCTGCCATTTTCGGACTCATGTGATA

Full Affymetrix probeset data:

Annotations for 1623558_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720