Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623562_at:

>probe:Drosophila_2:1623562_at:576:33; Interrogation_Position=2703; Antisense; ATCAAGTCCGCGATTGTGGCCAGCA
>probe:Drosophila_2:1623562_at:705:111; Interrogation_Position=2724; Antisense; AGCACGGCGATAGTGGTCACCGCGT
>probe:Drosophila_2:1623562_at:309:37; Interrogation_Position=2766; Antisense; ATCTTCGTCGTGTGCCGATGGAAAC
>probe:Drosophila_2:1623562_at:526:391; Interrogation_Position=2803; Antisense; GAAAGAGCAGCTACCTGCGCACCTA
>probe:Drosophila_2:1623562_at:379:537; Interrogation_Position=2906; Antisense; GGTCATTGGATCCAGTTCGGGAACA
>probe:Drosophila_2:1623562_at:106:213; Interrogation_Position=2961; Antisense; AAGACGGGCATAGCCAGCATCTCCA
>probe:Drosophila_2:1623562_at:306:335; Interrogation_Position=3017; Antisense; GCTGCAGCGGCAGAGTTCAATGCTC
>probe:Drosophila_2:1623562_at:665:651; Interrogation_Position=3033; Antisense; TCAATGCTCTTTGCCCGCGATGGAT
>probe:Drosophila_2:1623562_at:336:441; Interrogation_Position=3051; Antisense; GATGGATCCGCCACGATGAGCACCG
>probe:Drosophila_2:1623562_at:282:335; Interrogation_Position=3083; Antisense; GCTGACCACGAATAGCACCACGAAT
>probe:Drosophila_2:1623562_at:271:579; Interrogation_Position=3165; Antisense; GGCCTGGCCATTTCGCTGAGAAGTG
>probe:Drosophila_2:1623562_at:298:65; Interrogation_Position=3210; Antisense; ATGGATCCCAGTTCGCCGGAGGTGC
>probe:Drosophila_2:1623562_at:663:683; Interrogation_Position=3240; Antisense; TATCTATTCGACACACTGCGCAAAT
>probe:Drosophila_2:1623562_at:336:145; Interrogation_Position=3254; Antisense; ACTGCGCAAATCCTTCGACAATTAG

Paste this into a BLAST search page for me
ATCAAGTCCGCGATTGTGGCCAGCAAGCACGGCGATAGTGGTCACCGCGTATCTTCGTCGTGTGCCGATGGAAACGAAAGAGCAGCTACCTGCGCACCTAGGTCATTGGATCCAGTTCGGGAACAAAGACGGGCATAGCCAGCATCTCCAGCTGCAGCGGCAGAGTTCAATGCTCTCAATGCTCTTTGCCCGCGATGGATGATGGATCCGCCACGATGAGCACCGGCTGACCACGAATAGCACCACGAATGGCCTGGCCATTTCGCTGAGAAGTGATGGATCCCAGTTCGCCGGAGGTGCTATCTATTCGACACACTGCGCAAATACTGCGCAAATCCTTCGACAATTAG

Full Affymetrix probeset data:

Annotations for 1623562_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime