FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623564_at:

>probe:Drosophila_2:1623564_at:358:471; Interrogation_Position=250; Antisense; GTTCGTCCAACTGACAAGCAGCATT
>probe:Drosophila_2:1623564_at:34:587; Interrogation_Position=327; Antisense; TGGACAACGCCATCACCTGGGAGAC
>probe:Drosophila_2:1623564_at:397:187; Interrogation_Position=372; Antisense; AACAGCGGCGCATCGACTGGGATAG
>probe:Drosophila_2:1623564_at:260:593; Interrogation_Position=389; Antisense; TGGGATAGACTTACTTCGCAGCTGC
>probe:Drosophila_2:1623564_at:247:373; Interrogation_Position=427; Antisense; GAAGTTCGCAAACAGTAGCCGCTCC
>probe:Drosophila_2:1623564_at:525:47; Interrogation_Position=466; Antisense; ATCCGGTTCTGCTTGGCAGGATCAG
>probe:Drosophila_2:1623564_at:471:77; Interrogation_Position=483; Antisense; AGGATCAGGATCTCGGCCCAGGTCA
>probe:Drosophila_2:1623564_at:622:79; Interrogation_Position=502; Antisense; AGGTCACAGCAATTCCTCGCGGAAT
>probe:Drosophila_2:1623564_at:444:181; Interrogation_Position=557; Antisense; AAAAAGACCGAGATGCTGGCGCAGC
>probe:Drosophila_2:1623564_at:221:225; Interrogation_Position=588; Antisense; AAGGACTCGAGGTTCTATCAGCCAC
>probe:Drosophila_2:1623564_at:149:685; Interrogation_Position=603; Antisense; TATCAGCCACATTGTCCAGACAGCG
>probe:Drosophila_2:1623564_at:272:191; Interrogation_Position=683; Antisense; AACTTGGCCAATGCCATGGACCGTG
>probe:Drosophila_2:1623564_at:238:27; Interrogation_Position=791; Antisense; ATAGCCTTGTTCGTCGCCATCATTG
>probe:Drosophila_2:1623564_at:471:271; Interrogation_Position=808; Antisense; CATCATTGTCGTGGTCTTCGTCTAG

Paste this into a BLAST search page for me
GTTCGTCCAACTGACAAGCAGCATTTGGACAACGCCATCACCTGGGAGACAACAGCGGCGCATCGACTGGGATAGTGGGATAGACTTACTTCGCAGCTGCGAAGTTCGCAAACAGTAGCCGCTCCATCCGGTTCTGCTTGGCAGGATCAGAGGATCAGGATCTCGGCCCAGGTCAAGGTCACAGCAATTCCTCGCGGAATAAAAAGACCGAGATGCTGGCGCAGCAAGGACTCGAGGTTCTATCAGCCACTATCAGCCACATTGTCCAGACAGCGAACTTGGCCAATGCCATGGACCGTGATAGCCTTGTTCGTCGCCATCATTGCATCATTGTCGTGGTCTTCGTCTAG

Full Affymetrix probeset data:

Annotations for 1623564_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720