Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623565_at:

>probe:Drosophila_2:1623565_at:598:499; Interrogation_Position=1360; Antisense; GTCTGACCCGCAAAGTTCTTGCAAA
>probe:Drosophila_2:1623565_at:416:171; Interrogation_Position=1401; Antisense; AAAGTGTTGGCCATCGCATCGATAA
>probe:Drosophila_2:1623565_at:273:511; Interrogation_Position=1427; Antisense; GTGAAAACTACTCCTACAGCCAATC
>probe:Drosophila_2:1623565_at:84:493; Interrogation_Position=1470; Antisense; GTAACAACATGAAGCTCTCAGCAGT
>probe:Drosophila_2:1623565_at:642:649; Interrogation_Position=1487; Antisense; TCAGCAGTATTGTTGGCCATCGCGC
>probe:Drosophila_2:1623565_at:707:127; Interrogation_Position=1559; Antisense; ACCAAGTGCGTCATGGAGTGCGACA
>probe:Drosophila_2:1623565_at:700:75; Interrogation_Position=1587; Antisense; AGGAGTACCGATCCATTTGCGCTGC
>probe:Drosophila_2:1623565_at:48:695; Interrogation_Position=1602; Antisense; TTTGCGCTGCGGACGACAAGGGCTC
>probe:Drosophila_2:1623565_at:466:213; Interrogation_Position=1631; Antisense; AAGACCTATCGCAATCTGTGCGTGA
>probe:Drosophila_2:1623565_at:138:515; Interrogation_Position=1711; Antisense; GTGTCCGTAGAGCTATGGATCCATT
>probe:Drosophila_2:1623565_at:147:447; Interrogation_Position=1728; Antisense; GATCCATTGATCTGTAGTCCAGCGG
>probe:Drosophila_2:1623565_at:511:295; Interrogation_Position=1777; Antisense; CGAGTTGACGCGGTTTGGCATTCCG
>probe:Drosophila_2:1623565_at:427:721; Interrogation_Position=1791; Antisense; TTGGCATTCCGGAGGACTCATCTTT
>probe:Drosophila_2:1623565_at:448:363; Interrogation_Position=1861; Antisense; GAATACAGAAAACACGCCCCGAACG

Paste this into a BLAST search page for me
GTCTGACCCGCAAAGTTCTTGCAAAAAAGTGTTGGCCATCGCATCGATAAGTGAAAACTACTCCTACAGCCAATCGTAACAACATGAAGCTCTCAGCAGTTCAGCAGTATTGTTGGCCATCGCGCACCAAGTGCGTCATGGAGTGCGACAAGGAGTACCGATCCATTTGCGCTGCTTTGCGCTGCGGACGACAAGGGCTCAAGACCTATCGCAATCTGTGCGTGAGTGTCCGTAGAGCTATGGATCCATTGATCCATTGATCTGTAGTCCAGCGGCGAGTTGACGCGGTTTGGCATTCCGTTGGCATTCCGGAGGACTCATCTTTGAATACAGAAAACACGCCCCGAACG

Full Affymetrix probeset data:

Annotations for 1623565_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime