Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623566_at:

>probe:Drosophila_2:1623566_at:298:129; Interrogation_Position=2623; Antisense; ACCAGATTCGACAGCAACTTCAGTT
>probe:Drosophila_2:1623566_at:143:257; Interrogation_Position=2665; Antisense; CACGAGGCTACGGAGGGTTCCATCA
>probe:Drosophila_2:1623566_at:528:703; Interrogation_Position=2745; Antisense; TTACTTCAAGCTTCTTCTGCAAGGC
>probe:Drosophila_2:1623566_at:662:71; Interrogation_Position=2766; Antisense; AGGCTTTCAGCCCTTTTTGTGCAAT
>probe:Drosophila_2:1623566_at:597:129; Interrogation_Position=2829; Antisense; ACCGGCGCTCATCATGAACTACATT
>probe:Drosophila_2:1623566_at:149:403; Interrogation_Position=2854; Antisense; GACTACCGGGTCAAGCAGAAGCTAA
>probe:Drosophila_2:1623566_at:395:75; Interrogation_Position=2891; Antisense; AGGACCAGACCAAGATCTCGCTGTT
>probe:Drosophila_2:1623566_at:286:635; Interrogation_Position=2908; Antisense; TCGCTGTTCGAGGATGGCTTCGCCA
>probe:Drosophila_2:1623566_at:443:591; Interrogation_Position=2939; Antisense; TGGTCTACATCCTCAACATGCTGAA
>probe:Drosophila_2:1623566_at:636:93; Interrogation_Position=2975; Antisense; AGTTCCATGAGCTGGGCTGGAGCCA
>probe:Drosophila_2:1623566_at:393:377; Interrogation_Position=3090; Antisense; GAAGCTTCACCAGACAGTGGCGATA
>probe:Drosophila_2:1623566_at:467:381; Interrogation_Position=3129; Antisense; GAACGCCTACGAGCATGAATACAAT
>probe:Drosophila_2:1623566_at:432:161; Interrogation_Position=3149; Antisense; ACAATCTATTGTACGCCACCTTGAG
>probe:Drosophila_2:1623566_at:182:431; Interrogation_Position=3171; Antisense; GAGTAGCTCCGAAATATTCTTCCAA

Paste this into a BLAST search page for me
ACCAGATTCGACAGCAACTTCAGTTCACGAGGCTACGGAGGGTTCCATCATTACTTCAAGCTTCTTCTGCAAGGCAGGCTTTCAGCCCTTTTTGTGCAATACCGGCGCTCATCATGAACTACATTGACTACCGGGTCAAGCAGAAGCTAAAGGACCAGACCAAGATCTCGCTGTTTCGCTGTTCGAGGATGGCTTCGCCATGGTCTACATCCTCAACATGCTGAAAGTTCCATGAGCTGGGCTGGAGCCAGAAGCTTCACCAGACAGTGGCGATAGAACGCCTACGAGCATGAATACAATACAATCTATTGTACGCCACCTTGAGGAGTAGCTCCGAAATATTCTTCCAA

Full Affymetrix probeset data:

Annotations for 1623566_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime