FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623567_at:

>probe:Drosophila_2:1623567_at:363:9; Interrogation_Position=107; Antisense; ATTCCACAAGTCTGCACAAGTATGA
>probe:Drosophila_2:1623567_at:535:217; Interrogation_Position=124; Antisense; AAGTATGACCATACATTTGCTGGAA
>probe:Drosophila_2:1623567_at:370:67; Interrogation_Position=13; Antisense; ATGGCTGGTTCTTGGGATCTGGCCA
>probe:Drosophila_2:1623567_at:647:327; Interrogation_Position=142; Antisense; GCTGGAAAGCCTTTAAGCCACCTAA
>probe:Drosophila_2:1623567_at:156:365; Interrogation_Position=173; Antisense; GAATAACGGTACTTCTTCATCGATT
>probe:Drosophila_2:1623567_at:353:539; Interrogation_Position=180; Antisense; GGTACTTCTTCATCGATTTTACATC
>probe:Drosophila_2:1623567_at:255:461; Interrogation_Position=194; Antisense; GATTTTACATCTGCGTGTTCTCGAC
>probe:Drosophila_2:1623567_at:546:667; Interrogation_Position=199; Antisense; TACATCTGCGTGTTCTCGACTCGGG
>probe:Drosophila_2:1623567_at:542:523; Interrogation_Position=222; Antisense; GGGCGACACTTCATTGTTGCCGCGC
>probe:Drosophila_2:1623567_at:704:1; Interrogation_Position=234; Antisense; ATTGTTGCCGCGCAAACAGACTGGG
>probe:Drosophila_2:1623567_at:384:41; Interrogation_Position=29; Antisense; ATCTGGCCAGGTCTTTGGACTTGGA
>probe:Drosophila_2:1623567_at:608:585; Interrogation_Position=44; Antisense; TGGACTTGGACTTGGCCATCGGCTG
>probe:Drosophila_2:1623567_at:172:649; Interrogation_Position=74; Antisense; TCAGTGGTCGGAAGGCATGTGACAT
>probe:Drosophila_2:1623567_at:202:511; Interrogation_Position=92; Antisense; GTGACATGGGCAGACATTCCACAAG

Paste this into a BLAST search page for me
ATTCCACAAGTCTGCACAAGTATGAAAGTATGACCATACATTTGCTGGAAATGGCTGGTTCTTGGGATCTGGCCAGCTGGAAAGCCTTTAAGCCACCTAAGAATAACGGTACTTCTTCATCGATTGGTACTTCTTCATCGATTTTACATCGATTTTACATCTGCGTGTTCTCGACTACATCTGCGTGTTCTCGACTCGGGGGGCGACACTTCATTGTTGCCGCGCATTGTTGCCGCGCAAACAGACTGGGATCTGGCCAGGTCTTTGGACTTGGATGGACTTGGACTTGGCCATCGGCTGTCAGTGGTCGGAAGGCATGTGACATGTGACATGGGCAGACATTCCACAAG

Full Affymetrix probeset data:

Annotations for 1623567_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720