FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623570_at:

>probe:Drosophila_2:1623570_at:273:175; Interrogation_Position=540; Antisense; AAACCGCGGCATTCCTAATGATGGA
>probe:Drosophila_2:1623570_at:566:303; Interrogation_Position=620; Antisense; CCGATGCTTCCGAACTTAAACCAGT
>probe:Drosophila_2:1623570_at:115:175; Interrogation_Position=637; Antisense; AAACCAGTTGTTGTAATGCCCAGCA
>probe:Drosophila_2:1623570_at:289:39; Interrogation_Position=684; Antisense; ATCTACATCAATGCCCAAGCGAGTA
>probe:Drosophila_2:1623570_at:493:37; Interrogation_Position=728; Antisense; ATCTTCTGATGGGTGGCACGACCAC
>probe:Drosophila_2:1623570_at:572:543; Interrogation_Position=765; Antisense; GGATATGATGACACCACCATCTATG
>probe:Drosophila_2:1623570_at:245:443; Interrogation_Position=799; Antisense; GATGAGCTATGCACCAAGTTCGAGT
>probe:Drosophila_2:1623570_at:515:189; Interrogation_Position=814; Antisense; AAGTTCGAGTACTCGCCCATTTGTG
>probe:Drosophila_2:1623570_at:38:693; Interrogation_Position=833; Antisense; TTTGTGCCCACAATGGAATCTGCAT
>probe:Drosophila_2:1623570_at:22:509; Interrogation_Position=876; Antisense; GTGCGTAATGAACACCTTCAACTGC
>probe:Drosophila_2:1623570_at:44:653; Interrogation_Position=893; Antisense; TCAACTGCAAACACCGCGATTTGTC
>probe:Drosophila_2:1623570_at:139:21; Interrogation_Position=911; Antisense; ATTTGTCGTTCCGTGCAGTGGATGA
>probe:Drosophila_2:1623570_at:356:63; Interrogation_Position=938; Antisense; ATGTGTGCCGACTGGGAGTTTGCAT
>probe:Drosophila_2:1623570_at:466:227; Interrogation_Position=997; Antisense; AATGGCGATTACTCTTAGTCATAGT

Paste this into a BLAST search page for me
AAACCGCGGCATTCCTAATGATGGACCGATGCTTCCGAACTTAAACCAGTAAACCAGTTGTTGTAATGCCCAGCAATCTACATCAATGCCCAAGCGAGTAATCTTCTGATGGGTGGCACGACCACGGATATGATGACACCACCATCTATGGATGAGCTATGCACCAAGTTCGAGTAAGTTCGAGTACTCGCCCATTTGTGTTTGTGCCCACAATGGAATCTGCATGTGCGTAATGAACACCTTCAACTGCTCAACTGCAAACACCGCGATTTGTCATTTGTCGTTCCGTGCAGTGGATGAATGTGTGCCGACTGGGAGTTTGCATAATGGCGATTACTCTTAGTCATAGT

Full Affymetrix probeset data:

Annotations for 1623570_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720