Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623572_at:

>probe:Drosophila_2:1623572_at:370:495; Interrogation_Position=3622; Antisense; GTCAGCGTATTGTCCAGCTTTTGGA
>probe:Drosophila_2:1623572_at:148:173; Interrogation_Position=3662; Antisense; AAAGATGCCGGTACTGCCGAGGTCT
>probe:Drosophila_2:1623572_at:235:593; Interrogation_Position=3714; Antisense; TGGGTGTTGGACTACGCGCAGATAA
>probe:Drosophila_2:1623572_at:232:399; Interrogation_Position=3798; Antisense; GACACGGATGACTACTTGAACTTTG
>probe:Drosophila_2:1623572_at:190:149; Interrogation_Position=3817; Antisense; ACTTTGTGGAATATCTCGCTGGCGA
>probe:Drosophila_2:1623572_at:474:563; Interrogation_Position=3871; Antisense; GGAATCCGCCCCAAGGAATTGTGTA
>probe:Drosophila_2:1623572_at:568:341; Interrogation_Position=3919; Antisense; GCTTCCTGAGCGCATGGTACTATGA
>probe:Drosophila_2:1623572_at:428:511; Interrogation_Position=3949; Antisense; GTGAGCCTCAGATTTACGAGCCCGT
>probe:Drosophila_2:1623572_at:89:469; Interrogation_Position=3972; Antisense; GTTCCCGCCGAAGAGAATGCCCAGA
>probe:Drosophila_2:1623572_at:291:113; Interrogation_Position=4006; Antisense; AGCAGCCATCATCACAAGCGGAGGT
>probe:Drosophila_2:1623572_at:568:99; Interrogation_Position=4081; Antisense; AGAGGTTTCACCAGCGTCAGGATGA
>probe:Drosophila_2:1623572_at:285:625; Interrogation_Position=4117; Antisense; TGCGCGAGCTCAACAGGTCACATAA
>probe:Drosophila_2:1623572_at:274:437; Interrogation_Position=4151; Antisense; GAGGAGAGACGCATCGGACCACAAA
>probe:Drosophila_2:1623572_at:33:207; Interrogation_Position=4191; Antisense; AAGCGCAAGCGGTCCAAATCCAAGT

Paste this into a BLAST search page for me
GTCAGCGTATTGTCCAGCTTTTGGAAAAGATGCCGGTACTGCCGAGGTCTTGGGTGTTGGACTACGCGCAGATAAGACACGGATGACTACTTGAACTTTGACTTTGTGGAATATCTCGCTGGCGAGGAATCCGCCCCAAGGAATTGTGTAGCTTCCTGAGCGCATGGTACTATGAGTGAGCCTCAGATTTACGAGCCCGTGTTCCCGCCGAAGAGAATGCCCAGAAGCAGCCATCATCACAAGCGGAGGTAGAGGTTTCACCAGCGTCAGGATGATGCGCGAGCTCAACAGGTCACATAAGAGGAGAGACGCATCGGACCACAAAAAGCGCAAGCGGTCCAAATCCAAGT

Full Affymetrix probeset data:

Annotations for 1623572_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime