FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623574_at:

>probe:Drosophila_2:1623574_at:579:111; Interrogation_Position=319; Antisense; AGCAACTGGCCGACAAAGCGCTGGC
>probe:Drosophila_2:1623574_at:279:109; Interrogation_Position=359; Antisense; AGAAGCTGCTCTGGCCGGCAAGCAA
>probe:Drosophila_2:1623574_at:450:75; Interrogation_Position=439; Antisense; AGGAGAGCACCTTGTTACAGACCAC
>probe:Drosophila_2:1623574_at:114:709; Interrogation_Position=453; Antisense; TTACAGACCACCCAAACTACTTATG
>probe:Drosophila_2:1623574_at:177:193; Interrogation_Position=467; Antisense; AACTACTTATGCTGCGGCCGGGCAA
>probe:Drosophila_2:1623574_at:608:189; Interrogation_Position=499; Antisense; AACAGGCGGCAGATCAGCTGAACAC
>probe:Drosophila_2:1623574_at:306:119; Interrogation_Position=514; Antisense; AGCTGAACACCATTACGCTGGCGGT
>probe:Drosophila_2:1623574_at:421:369; Interrogation_Position=542; Antisense; GAATGCGCAGGATAATGTGGTCAAC
>probe:Drosophila_2:1623574_at:553:589; Interrogation_Position=559; Antisense; TGGTCAACTCGGAGCACGTGGCCAG
>probe:Drosophila_2:1623574_at:651:111; Interrogation_Position=610; Antisense; AGCAACAGCTTGTGGAAGCGGCCAA
>probe:Drosophila_2:1623574_at:558:81; Interrogation_Position=667; Antisense; AGGTGGCCCGTGTGGATTTCAAGAA
>probe:Drosophila_2:1623574_at:518:179; Interrogation_Position=696; Antisense; AAAAACGCCGCCGAGAAGGCAGCCT
>probe:Drosophila_2:1623574_at:483:195; Interrogation_Position=772; Antisense; AACTGAGGCACTTACTCTGGCTGAA
>probe:Drosophila_2:1623574_at:638:323; Interrogation_Position=803; Antisense; GCGCACCAACTGAAGCCAATAACTT

Paste this into a BLAST search page for me
AGCAACTGGCCGACAAAGCGCTGGCAGAAGCTGCTCTGGCCGGCAAGCAAAGGAGAGCACCTTGTTACAGACCACTTACAGACCACCCAAACTACTTATGAACTACTTATGCTGCGGCCGGGCAAAACAGGCGGCAGATCAGCTGAACACAGCTGAACACCATTACGCTGGCGGTGAATGCGCAGGATAATGTGGTCAACTGGTCAACTCGGAGCACGTGGCCAGAGCAACAGCTTGTGGAAGCGGCCAAAGGTGGCCCGTGTGGATTTCAAGAAAAAAACGCCGCCGAGAAGGCAGCCTAACTGAGGCACTTACTCTGGCTGAAGCGCACCAACTGAAGCCAATAACTT

Full Affymetrix probeset data:

Annotations for 1623574_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720