FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623576_at:

>probe:Drosophila_2:1623576_at:235:327; Interrogation_Position=1584; Antisense; GCAGATCGTCGGCTCGAGGAAACCC
>probe:Drosophila_2:1623576_at:565:433; Interrogation_Position=1599; Antisense; GAGGAAACCCGCATTCTGGAGGCCG
>probe:Drosophila_2:1623576_at:348:641; Interrogation_Position=1613; Antisense; TCTGGAGGCCGAGCGTCTAAAGATC
>probe:Drosophila_2:1623576_at:685:75; Interrogation_Position=1675; Antisense; AGGAGCTCCTCCAGTTGAAGGCCAC
>probe:Drosophila_2:1623576_at:464:353; Interrogation_Position=1704; Antisense; GCAGCCACCGTACCCGAGAAGGACA
>probe:Drosophila_2:1623576_at:73:75; Interrogation_Position=1723; Antisense; AGGACACTCCTGAATATCTGCGCAA
>probe:Drosophila_2:1623576_at:446:227; Interrogation_Position=1746; Antisense; AAGGCGGAGCAGTTCAAGATCATCA
>probe:Drosophila_2:1623576_at:314:207; Interrogation_Position=1760; Antisense; CAAGATCATCAACAACCAGGTGCAG
>probe:Drosophila_2:1623576_at:466:169; Interrogation_Position=1829; Antisense; AAATGGCTTCTTCCTGCGCATCCAA
>probe:Drosophila_2:1623576_at:575:469; Interrogation_Position=1944; Antisense; GTTCGATACACCACCAAGTCAGCAG
>probe:Drosophila_2:1623576_at:225:7; Interrogation_Position=2013; Antisense; ATTGCCTCCGAATTGAAGCAGCAGG
>probe:Drosophila_2:1623576_at:263:209; Interrogation_Position=2028; Antisense; AAGCAGCAGGTCACATACAGCTCCA
>probe:Drosophila_2:1623576_at:337:117; Interrogation_Position=2046; Antisense; AGCTCCACGTCGTCCAGTGAACTGG
>probe:Drosophila_2:1623576_at:520:511; Interrogation_Position=2062; Antisense; GTGAACTGGACAAAGCCACCCGGGA

Paste this into a BLAST search page for me
GCAGATCGTCGGCTCGAGGAAACCCGAGGAAACCCGCATTCTGGAGGCCGTCTGGAGGCCGAGCGTCTAAAGATCAGGAGCTCCTCCAGTTGAAGGCCACGCAGCCACCGTACCCGAGAAGGACAAGGACACTCCTGAATATCTGCGCAAAAGGCGGAGCAGTTCAAGATCATCACAAGATCATCAACAACCAGGTGCAGAAATGGCTTCTTCCTGCGCATCCAAGTTCGATACACCACCAAGTCAGCAGATTGCCTCCGAATTGAAGCAGCAGGAAGCAGCAGGTCACATACAGCTCCAAGCTCCACGTCGTCCAGTGAACTGGGTGAACTGGACAAAGCCACCCGGGA

Full Affymetrix probeset data:

Annotations for 1623576_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720