FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623579_at:

>probe:Drosophila_2:1623579_at:524:257; Interrogation_Position=108; Antisense; CACTGCTTTTGACCTGCGAGTTGGG
>probe:Drosophila_2:1623579_at:264:417; Interrogation_Position=15; Antisense; GAGCGCCAAGAGAATTAACCTGATT
>probe:Drosophila_2:1623579_at:12:365; Interrogation_Position=201; Antisense; GAATCAAATTCCATTGCCGAGGATG
>probe:Drosophila_2:1623579_at:657:191; Interrogation_Position=248; Antisense; AACGACTCAACGGATACAGGCCTTT
>probe:Drosophila_2:1623579_at:345:661; Interrogation_Position=262; Antisense; TACAGGCCTTTTCTCTACAACATAA
>probe:Drosophila_2:1623579_at:76:223; Interrogation_Position=313; Antisense; AATCCAAAATCTAACCCAGTCCTGA
>probe:Drosophila_2:1623579_at:702:21; Interrogation_Position=339; Antisense; ATATATCTTCGACTCATTTTCCGCG
>probe:Drosophila_2:1623579_at:600:279; Interrogation_Position=351; Antisense; CTCATTTTCCGCGTATTCCAATATG
>probe:Drosophila_2:1623579_at:88:243; Interrogation_Position=370; Antisense; AATATGAACCACTCATGTCCCTACA
>probe:Drosophila_2:1623579_at:685:501; Interrogation_Position=386; Antisense; GTCCCTACACGAGCGACTTAATTGT
>probe:Drosophila_2:1623579_at:648:391; Interrogation_Position=412; Antisense; GAAAGGCTGCCCATTGGTTTTATGA
>probe:Drosophila_2:1623579_at:218:633; Interrogation_Position=464; Antisense; TCCCCGAGGGCAATTACCTGTTTGA
>probe:Drosophila_2:1623579_at:195:481; Interrogation_Position=483; Antisense; GTTTGAGTTTCACTTTAGTCGCCGA
>probe:Drosophila_2:1623579_at:348:671; Interrogation_Position=93; Antisense; TACGAACTTAAACTGCACTGCTTTT

Paste this into a BLAST search page for me
CACTGCTTTTGACCTGCGAGTTGGGGAGCGCCAAGAGAATTAACCTGATTGAATCAAATTCCATTGCCGAGGATGAACGACTCAACGGATACAGGCCTTTTACAGGCCTTTTCTCTACAACATAAAATCCAAAATCTAACCCAGTCCTGAATATATCTTCGACTCATTTTCCGCGCTCATTTTCCGCGTATTCCAATATGAATATGAACCACTCATGTCCCTACAGTCCCTACACGAGCGACTTAATTGTGAAAGGCTGCCCATTGGTTTTATGATCCCCGAGGGCAATTACCTGTTTGAGTTTGAGTTTCACTTTAGTCGCCGATACGAACTTAAACTGCACTGCTTTT

Full Affymetrix probeset data:

Annotations for 1623579_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720