Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623580_at:

>probe:Drosophila_2:1623580_at:8:133; Interrogation_Position=1293; Antisense; ACCCACCGTGGTGCCTGGAGGTGAT
>probe:Drosophila_2:1623580_at:91:607; Interrogation_Position=1557; Antisense; TGAGGAGTACTAAGCGTCACGCCAC
>probe:Drosophila_2:1623580_at:106:133; Interrogation_Position=1575; Antisense; ACGCCACTTCAACGCTCGATGGGAG
>probe:Drosophila_2:1623580_at:15:491; Interrogation_Position=1617; Antisense; GTAACCGTCGAAATCAGTGTTTACG
>probe:Drosophila_2:1623580_at:441:239; Interrogation_Position=1628; Antisense; AATCAGTGTTTACGCTTCCAATCGC
>probe:Drosophila_2:1623580_at:481:477; Interrogation_Position=1635; Antisense; GTTTACGCTTCCAATCGCAACAAAA
>probe:Drosophila_2:1623580_at:436:245; Interrogation_Position=1660; Antisense; AATTCACTGCAACACTGAAAAGCAT
>probe:Drosophila_2:1623580_at:188:135; Interrogation_Position=1691; Antisense; ACGATGAAGATTGTACGAGAAACCA
>probe:Drosophila_2:1623580_at:235:481; Interrogation_Position=1720; Antisense; GTATTTTATCCACAAAGACACGTAT
>probe:Drosophila_2:1623580_at:426:395; Interrogation_Position=1736; Antisense; GACACGTATAGCAGAAAAGCCAAGT
>probe:Drosophila_2:1623580_at:690:203; Interrogation_Position=1752; Antisense; AAGCCAAGTTAACTCGGCGATAAGT
>probe:Drosophila_2:1623580_at:383:145; Interrogation_Position=1763; Antisense; ACTCGGCGATAAGTTGTGTACACAA
>probe:Drosophila_2:1623580_at:64:515; Interrogation_Position=1778; Antisense; GTGTACACAAGAATAAAATCGGCCA
>probe:Drosophila_2:1623580_at:410:237; Interrogation_Position=1794; Antisense; AATCGGCCAGATTCAGTGTTGTCAG

Paste this into a BLAST search page for me
ACCCACCGTGGTGCCTGGAGGTGATTGAGGAGTACTAAGCGTCACGCCACACGCCACTTCAACGCTCGATGGGAGGTAACCGTCGAAATCAGTGTTTACGAATCAGTGTTTACGCTTCCAATCGCGTTTACGCTTCCAATCGCAACAAAAAATTCACTGCAACACTGAAAAGCATACGATGAAGATTGTACGAGAAACCAGTATTTTATCCACAAAGACACGTATGACACGTATAGCAGAAAAGCCAAGTAAGCCAAGTTAACTCGGCGATAAGTACTCGGCGATAAGTTGTGTACACAAGTGTACACAAGAATAAAATCGGCCAAATCGGCCAGATTCAGTGTTGTCAG

Full Affymetrix probeset data:

Annotations for 1623580_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime