FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623585_at:

>probe:Drosophila_2:1623585_at:34:135; Interrogation_Position=1790; Antisense; ACGCCATCTATGACACTCGAACTGG
>probe:Drosophila_2:1623585_at:567:595; Interrogation_Position=1818; Antisense; TGTGTCCACCGCCTTGCAGTTGCAA
>probe:Drosophila_2:1623585_at:101:71; Interrogation_Position=1844; Antisense; AGGCGCAGCAGCAGTACTCCCTGGA
>probe:Drosophila_2:1623585_at:319:631; Interrogation_Position=1861; Antisense; TCCCTGGACCATCTGGAGGCGCAGT
>probe:Drosophila_2:1623585_at:357:351; Interrogation_Position=1914; Antisense; GCAGATTGCGCGGTTGCAGCAACAA
>probe:Drosophila_2:1623585_at:155:491; Interrogation_Position=1974; Antisense; GTACATGGCCAAGTTGATGCAGCAG
>probe:Drosophila_2:1623585_at:648:323; Interrogation_Position=1998; Antisense; GCGACAGGGCCCGAATGGAACATAT
>probe:Drosophila_2:1623585_at:67:725; Interrogation_Position=2038; Antisense; TTGCTACAGGCGGAGCGCAGGACAC
>probe:Drosophila_2:1623585_at:508:73; Interrogation_Position=2056; Antisense; AGGACACCCGATGCCTATGGGCGCT
>probe:Drosophila_2:1623585_at:532:679; Interrogation_Position=2071; Antisense; TATGGGCGCTCCAAGCAGCAGCGGC
>probe:Drosophila_2:1623585_at:621:259; Interrogation_Position=2111; Antisense; CAGCTGCAGCAGACTACGAGGATAT
>probe:Drosophila_2:1623585_at:381:665; Interrogation_Position=2137; Antisense; TACAACATGTCGCAACTGGCAGGTG
>probe:Drosophila_2:1623585_at:660:67; Interrogation_Position=2246; Antisense; ATGGCAGCAAGCATGTGCCCGCGAT
>probe:Drosophila_2:1623585_at:276:141; Interrogation_Position=2277; Antisense; ACGGTACACGCCCAATCATTTGGAG

Paste this into a BLAST search page for me
ACGCCATCTATGACACTCGAACTGGTGTGTCCACCGCCTTGCAGTTGCAAAGGCGCAGCAGCAGTACTCCCTGGATCCCTGGACCATCTGGAGGCGCAGTGCAGATTGCGCGGTTGCAGCAACAAGTACATGGCCAAGTTGATGCAGCAGGCGACAGGGCCCGAATGGAACATATTTGCTACAGGCGGAGCGCAGGACACAGGACACCCGATGCCTATGGGCGCTTATGGGCGCTCCAAGCAGCAGCGGCCAGCTGCAGCAGACTACGAGGATATTACAACATGTCGCAACTGGCAGGTGATGGCAGCAAGCATGTGCCCGCGATACGGTACACGCCCAATCATTTGGAG

Full Affymetrix probeset data:

Annotations for 1623585_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720