Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623587_at:

>probe:Drosophila_2:1623587_at:676:89; Interrogation_Position=125; Antisense; AGTTTCCAGGACTCTCACAGATTGC
>probe:Drosophila_2:1623587_at:355:95; Interrogation_Position=143; Antisense; AGATTGCCATAGCTCCAGGTCCTGA
>probe:Drosophila_2:1623587_at:673:19; Interrogation_Position=187; Antisense; ATATTCGGGCAGTATCAGGTCAAGC
>probe:Drosophila_2:1623587_at:392:203; Interrogation_Position=214; Antisense; AACCAGGATCCCTATGGTCATGTGG
>probe:Drosophila_2:1623587_at:351:115; Interrogation_Position=240; Antisense; AGCATTGACTGTATCTCCGGAGTAC
>probe:Drosophila_2:1623587_at:340:407; Interrogation_Position=275; Antisense; GACTGGCCACTGCTCTAATGGATTT
>probe:Drosophila_2:1623587_at:701:115; Interrogation_Position=327; Antisense; AGCTTCCTATGTTAACCTCTTTATG
>probe:Drosophila_2:1623587_at:723:323; Interrogation_Position=351; Antisense; GCGAATCAGTAATCGGGCTGCCTAT
>probe:Drosophila_2:1623587_at:368:573; Interrogation_Position=366; Antisense; GGCTGCCTATCAATTGTACACTTCT
>probe:Drosophila_2:1623587_at:108:491; Interrogation_Position=381; Antisense; GTACACTTCTTTGGGTTATGCTCAT
>probe:Drosophila_2:1623587_at:229:593; Interrogation_Position=392; Antisense; TGGGTTATGCTCATCGCCAAACATT
>probe:Drosophila_2:1623587_at:197:191; Interrogation_Position=411; Antisense; AACATTCCTGGACTACTATCCGGAT
>probe:Drosophila_2:1623587_at:453:13; Interrogation_Position=59; Antisense; ATTCACTAGTTTTCGATGCTCTCAC
>probe:Drosophila_2:1623587_at:552:337; Interrogation_Position=76; Antisense; GCTCTCACCGAGGTTTATAGCCTGA

Paste this into a BLAST search page for me
AGTTTCCAGGACTCTCACAGATTGCAGATTGCCATAGCTCCAGGTCCTGAATATTCGGGCAGTATCAGGTCAAGCAACCAGGATCCCTATGGTCATGTGGAGCATTGACTGTATCTCCGGAGTACGACTGGCCACTGCTCTAATGGATTTAGCTTCCTATGTTAACCTCTTTATGGCGAATCAGTAATCGGGCTGCCTATGGCTGCCTATCAATTGTACACTTCTGTACACTTCTTTGGGTTATGCTCATTGGGTTATGCTCATCGCCAAACATTAACATTCCTGGACTACTATCCGGATATTCACTAGTTTTCGATGCTCTCACGCTCTCACCGAGGTTTATAGCCTGA

Full Affymetrix probeset data:

Annotations for 1623587_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime