FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623588_at:

>probe:Drosophila_2:1623588_at:242:99; Interrogation_Position=1207; Antisense; AGATGACATCAAGCGCGGCATGGTC
>probe:Drosophila_2:1623588_at:317:309; Interrogation_Position=1276; Antisense; CCAGGTGTACATCCTGTCCAAGGAT
>probe:Drosophila_2:1623588_at:216:505; Interrogation_Position=1291; Antisense; GTCCAAGGATGAAGGCGGTCGCACA
>probe:Drosophila_2:1623588_at:171:61; Interrogation_Position=1325; Antisense; ATGTCCTTCATCCAACTGCAGATGT
>probe:Drosophila_2:1623588_at:354:291; Interrogation_Position=1372; Antisense; CGTGCAGGTGCAGATTCCCGATAAG
>probe:Drosophila_2:1623588_at:400:31; Interrogation_Position=1392; Antisense; ATAAGGAGATGGTCATGCCCGGCGA
>probe:Drosophila_2:1623588_at:647:575; Interrogation_Position=1412; Antisense; GGCGAAGACACCAAGCTCATTCTGC
>probe:Drosophila_2:1623588_at:611:645; Interrogation_Position=1440; Antisense; TCATCCGGCCAATGGTCCTGGAGCA
>probe:Drosophila_2:1623588_at:698:551; Interrogation_Position=1459; Antisense; GGAGCAGGGACAACGCTTCACGCTG
>probe:Drosophila_2:1623588_at:64:621; Interrogation_Position=1482; Antisense; TGCGTGACGGAAACCTGACCCTGGG
>probe:Drosophila_2:1623588_at:288:367; Interrogation_Position=1544; Antisense; GAATCGCAGCGATCCGAGTTGACGG
>probe:Drosophila_2:1623588_at:302:295; Interrogation_Position=1601; Antisense; GCTAAGAAGTAGATCCCCGGAACGC
>probe:Drosophila_2:1623588_at:90:289; Interrogation_Position=1618; Antisense; CGGAACGCCGTCAGTCATTAACTAA
>probe:Drosophila_2:1623588_at:621:727; Interrogation_Position=1685; Antisense; TTGGCGCTCCAATCACAATCGAGTA

Paste this into a BLAST search page for me
AGATGACATCAAGCGCGGCATGGTCCCAGGTGTACATCCTGTCCAAGGATGTCCAAGGATGAAGGCGGTCGCACAATGTCCTTCATCCAACTGCAGATGTCGTGCAGGTGCAGATTCCCGATAAGATAAGGAGATGGTCATGCCCGGCGAGGCGAAGACACCAAGCTCATTCTGCTCATCCGGCCAATGGTCCTGGAGCAGGAGCAGGGACAACGCTTCACGCTGTGCGTGACGGAAACCTGACCCTGGGGAATCGCAGCGATCCGAGTTGACGGGCTAAGAAGTAGATCCCCGGAACGCCGGAACGCCGTCAGTCATTAACTAATTGGCGCTCCAATCACAATCGAGTA

Full Affymetrix probeset data:

Annotations for 1623588_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720