Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623589_a_at:

>probe:Drosophila_2:1623589_a_at:462:715; Interrogation_Position=112; Antisense; TTCTGTGTGTTCTGATCTGATCGAC
>probe:Drosophila_2:1623589_a_at:546:299; Interrogation_Position=142; Antisense; CGCGTATGCGTGATATTGCCTCGAA
>probe:Drosophila_2:1623589_a_at:724:695; Interrogation_Position=184; Antisense; TTTAGTGTTTGTCCTTCGCTGCTTC
>probe:Drosophila_2:1623589_a_at:648:513; Interrogation_Position=235; Antisense; GTGTTCTGTGTCGTGCCGCAAATAA
>probe:Drosophila_2:1623589_a_at:691:359; Interrogation_Position=318; Antisense; GCAACTGCCAGCCAATATGTCGGTC
>probe:Drosophila_2:1623589_a_at:137:105; Interrogation_Position=353; Antisense; AGACGACGACCATTGTTGACCGGAT
>probe:Drosophila_2:1623589_a_at:599:289; Interrogation_Position=373; Antisense; CGGATGGTCAACTTCTTCGTGGAGC
>probe:Drosophila_2:1623589_a_at:346:209; Interrogation_Position=415; Antisense; AAGCAATGGTTCCTTTCGAATGCCC
>probe:Drosophila_2:1623589_a_at:406:555; Interrogation_Position=442; Antisense; GGACCGCTGTTCATGATCCTTGGAG
>probe:Drosophila_2:1623589_a_at:613:73; Interrogation_Position=492; Antisense; AGGACCTCGTTACATGCGCGATCGC
>probe:Drosophila_2:1623589_a_at:677:613; Interrogation_Position=530; Antisense; TGAAGAACACTCTCCTGGTCTACAA
>probe:Drosophila_2:1623589_a_at:108:665; Interrogation_Position=550; Antisense; TACAATGCGGTCCAAGTGCTCCTCA
>probe:Drosophila_2:1623589_a_at:129:531; Interrogation_Position=612; Antisense; GGGTGGCCACTACAACTTCAAGTGC
>probe:Drosophila_2:1623589_a_at:684:219; Interrogation_Position=631; Antisense; AAGTGCCAGCCGGTGACTTACGAAT

Paste this into a BLAST search page for me
TTCTGTGTGTTCTGATCTGATCGACCGCGTATGCGTGATATTGCCTCGAATTTAGTGTTTGTCCTTCGCTGCTTCGTGTTCTGTGTCGTGCCGCAAATAAGCAACTGCCAGCCAATATGTCGGTCAGACGACGACCATTGTTGACCGGATCGGATGGTCAACTTCTTCGTGGAGCAAGCAATGGTTCCTTTCGAATGCCCGGACCGCTGTTCATGATCCTTGGAGAGGACCTCGTTACATGCGCGATCGCTGAAGAACACTCTCCTGGTCTACAATACAATGCGGTCCAAGTGCTCCTCAGGGTGGCCACTACAACTTCAAGTGCAAGTGCCAGCCGGTGACTTACGAAT

Full Affymetrix probeset data:

Annotations for 1623589_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime