FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623592_at:

>probe:Drosophila_2:1623592_at:675:173; Interrogation_Position=4065; Antisense; AAAGCTCTCCGGTCATTGGATCGAC
>probe:Drosophila_2:1623592_at:64:43; Interrogation_Position=4084; Antisense; ATCGACTTTGAGAACATACCCGAAA
>probe:Drosophila_2:1623592_at:121:561; Interrogation_Position=4112; Antisense; GGAAACCGGCCAAGAGGATCACCAC
>probe:Drosophila_2:1623592_at:695:101; Interrogation_Position=4148; Antisense; AGACGTTGACGAGCAGTGTACCCGC
>probe:Drosophila_2:1623592_at:191:267; Interrogation_Position=4206; Antisense; CAGTGGTCATCGATCCGGAAGCGGA
>probe:Drosophila_2:1623592_at:527:289; Interrogation_Position=4221; Antisense; CGGAAGCGGAGCTGGCCATCATCAT
>probe:Drosophila_2:1623592_at:495:663; Interrogation_Position=4319; Antisense; TAAAGCCGGAGGACTGCCAGTGCGA
>probe:Drosophila_2:1623592_at:679:381; Interrogation_Position=4357; Antisense; GAACGCGGCGAATCCTCTCAAGCAA
>probe:Drosophila_2:1623592_at:73:197; Interrogation_Position=4428; Antisense; AACGGGCAGTGAGTCTCTGGCGTCC
>probe:Drosophila_2:1623592_at:669:511; Interrogation_Position=4472; Antisense; GTGAGGACATGTTGCCACTACTCGA
>probe:Drosophila_2:1623592_at:667:69; Interrogation_Position=4541; Antisense; AGGCGCCTCTAATGCGTCACAGTGG
>probe:Drosophila_2:1623592_at:357:527; Interrogation_Position=4569; Antisense; GGGAGTCAACCAACCCAGGAGCCAG
>probe:Drosophila_2:1623592_at:343:77; Interrogation_Position=4598; Antisense; AGGAGTTCTCAAGTCCTCGCAATCG
>probe:Drosophila_2:1623592_at:149:631; Interrogation_Position=4614; Antisense; TCGCAATCGCAAATTTCCCGACAGG

Paste this into a BLAST search page for me
AAAGCTCTCCGGTCATTGGATCGACATCGACTTTGAGAACATACCCGAAAGGAAACCGGCCAAGAGGATCACCACAGACGTTGACGAGCAGTGTACCCGCCAGTGGTCATCGATCCGGAAGCGGACGGAAGCGGAGCTGGCCATCATCATTAAAGCCGGAGGACTGCCAGTGCGAGAACGCGGCGAATCCTCTCAAGCAAAACGGGCAGTGAGTCTCTGGCGTCCGTGAGGACATGTTGCCACTACTCGAAGGCGCCTCTAATGCGTCACAGTGGGGGAGTCAACCAACCCAGGAGCCAGAGGAGTTCTCAAGTCCTCGCAATCGTCGCAATCGCAAATTTCCCGACAGG

Full Affymetrix probeset data:

Annotations for 1623592_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720