FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623594_at:

>probe:Drosophila_2:1623594_at:230:525; Interrogation_Position=2033; Antisense; GGGCTATGATGCAAGTCCTGGTGAT
>probe:Drosophila_2:1623594_at:664:591; Interrogation_Position=2051; Antisense; TGGTGATCGGTATCACGGCCTGCCG
>probe:Drosophila_2:1623594_at:604:723; Interrogation_Position=2146; Antisense; TTGAGAGTAGCGGTCACCTGTCCAC
>probe:Drosophila_2:1623594_at:653:649; Interrogation_Position=2176; Antisense; TCAGCGTGGAAGCTTTGGCCGCCAA
>probe:Drosophila_2:1623594_at:47:333; Interrogation_Position=2213; Antisense; GCTGACATCCTTCTGCGAAAGTGAT
>probe:Drosophila_2:1623594_at:652:541; Interrogation_Position=2238; Antisense; GGTTGCAACAACTACGAGCCAATCA
>probe:Drosophila_2:1623594_at:631:281; Interrogation_Position=2278; Antisense; CTCCCAGCAGCTTTCTCAAGAAGGT
>probe:Drosophila_2:1623594_at:724:109; Interrogation_Position=2296; Antisense; AGAAGGTGTAGACTGCCGCACATCC
>probe:Drosophila_2:1623594_at:177:153; Interrogation_Position=2315; Antisense; ACATCCGTCATCTGCTATTCACATC
>probe:Drosophila_2:1623594_at:58:119; Interrogation_Position=2353; Antisense; AGCTCGTTCGTCTCTGTATTGTAGA
>probe:Drosophila_2:1623594_at:350:85; Interrogation_Position=2393; Antisense; AGTGAAAACCACTCTCCGGATGTCA
>probe:Drosophila_2:1623594_at:417:607; Interrogation_Position=2490; Antisense; TGAGTTTTCCAATTGGGCGCACGGT
>probe:Drosophila_2:1623594_at:45:577; Interrogation_Position=2505; Antisense; GGCGCACGGTGCTTGGACAGAAAAA
>probe:Drosophila_2:1623594_at:105:79; Interrogation_Position=2543; Antisense; AGGTAGATTTCCATGTCGTTGCTGC

Paste this into a BLAST search page for me
GGGCTATGATGCAAGTCCTGGTGATTGGTGATCGGTATCACGGCCTGCCGTTGAGAGTAGCGGTCACCTGTCCACTCAGCGTGGAAGCTTTGGCCGCCAAGCTGACATCCTTCTGCGAAAGTGATGGTTGCAACAACTACGAGCCAATCACTCCCAGCAGCTTTCTCAAGAAGGTAGAAGGTGTAGACTGCCGCACATCCACATCCGTCATCTGCTATTCACATCAGCTCGTTCGTCTCTGTATTGTAGAAGTGAAAACCACTCTCCGGATGTCATGAGTTTTCCAATTGGGCGCACGGTGGCGCACGGTGCTTGGACAGAAAAAAGGTAGATTTCCATGTCGTTGCTGC

Full Affymetrix probeset data:

Annotations for 1623594_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720