Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623595_at:

>probe:Drosophila_2:1623595_at:38:167; Interrogation_Position=1222; Antisense; AAATCGCCTGCTTATCCGAAGGCTA
>probe:Drosophila_2:1623595_at:607:265; Interrogation_Position=1253; Antisense; CAGTTTGAAGAGACCGGCATCGACC
>probe:Drosophila_2:1623595_at:390:45; Interrogation_Position=1285; Antisense; ATCGCTGTGCTCCAATTTCCTGATA
>probe:Drosophila_2:1623595_at:493:695; Interrogation_Position=1300; Antisense; TTTCCTGATAACCATTCCGCATGTA
>probe:Drosophila_2:1623595_at:243:171; Interrogation_Position=1333; Antisense; AAAGACACAACGATCTGGTTCCCAC
>probe:Drosophila_2:1623595_at:695:589; Interrogation_Position=1348; Antisense; TGGTTCCCACTACACTTACGAAGTT
>probe:Drosophila_2:1623595_at:416:421; Interrogation_Position=1397; Antisense; GAGCACTGGACGTTTTTCAGACGCT
>probe:Drosophila_2:1623595_at:414:217; Interrogation_Position=1445; Antisense; AAGTCACTGCTTAAGACCCATCCGG
>probe:Drosophila_2:1623595_at:692:519; Interrogation_Position=1481; Antisense; GTGGAGTTTCCACCAAAGAAGCATT
>probe:Drosophila_2:1623595_at:583:689; Interrogation_Position=1504; Antisense; TTTCGGCAACATGAACCTGGTCTTC
>probe:Drosophila_2:1623595_at:547:587; Interrogation_Position=1521; Antisense; TGGTCTTCGTGGAGGAACGCCGCCA
>probe:Drosophila_2:1623595_at:304:331; Interrogation_Position=1613; Antisense; GCGGAGCTGCAAAAGGTCTTCCCCT
>probe:Drosophila_2:1623595_at:396:643; Interrogation_Position=1629; Antisense; TCTTCCCCTTCTTCAGGGATAGGTA
>probe:Drosophila_2:1623595_at:324:487; Interrogation_Position=1651; Antisense; GTAGCAATCTTTACCGAATCCAAAT

Paste this into a BLAST search page for me
AAATCGCCTGCTTATCCGAAGGCTACAGTTTGAAGAGACCGGCATCGACCATCGCTGTGCTCCAATTTCCTGATATTTCCTGATAACCATTCCGCATGTAAAAGACACAACGATCTGGTTCCCACTGGTTCCCACTACACTTACGAAGTTGAGCACTGGACGTTTTTCAGACGCTAAGTCACTGCTTAAGACCCATCCGGGTGGAGTTTCCACCAAAGAAGCATTTTTCGGCAACATGAACCTGGTCTTCTGGTCTTCGTGGAGGAACGCCGCCAGCGGAGCTGCAAAAGGTCTTCCCCTTCTTCCCCTTCTTCAGGGATAGGTAGTAGCAATCTTTACCGAATCCAAAT

Full Affymetrix probeset data:

Annotations for 1623595_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime