FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623596_at:

>probe:Drosophila_2:1623596_at:176:453; Interrogation_Position=108; Antisense; GATCAGTCAGTATCACCACCAGGAT
>probe:Drosophila_2:1623596_at:349:115; Interrogation_Position=134; Antisense; AGCATGGCCAGTACGCCTATGGTTA
>probe:Drosophila_2:1623596_at:275:475; Interrogation_Position=155; Antisense; GTTACATGGCACCACTGTATTCCAA
>probe:Drosophila_2:1623596_at:332:103; Interrogation_Position=185; Antisense; AGACCCGCACCGTGGATGGTGTGAT
>probe:Drosophila_2:1623596_at:90:227; Interrogation_Position=238; Antisense; AATGGCGAAACCCAGACCGTGGACT
>probe:Drosophila_2:1623596_at:596:447; Interrogation_Position=271; Antisense; GATGCCGAGGGCTTCCATGTAACCT
>probe:Drosophila_2:1623596_at:432:73; Interrogation_Position=323; Antisense; AGGAAACCCCTGAAGTGGCTGCACT
>probe:Drosophila_2:1623596_at:481:385; Interrogation_Position=350; Antisense; GAACACAGCATCTGGAGGCCCATAA
>probe:Drosophila_2:1623596_at:633:531; Interrogation_Position=441; Antisense; GGTGGCCGCCGCTAAGGTTGCATTC
>probe:Drosophila_2:1623596_at:425:541; Interrogation_Position=456; Antisense; GGTTGCATTCTTCAAGCGTTTCGAA
>probe:Drosophila_2:1623596_at:677:591; Interrogation_Position=524; Antisense; TGGTGATACCGAATCCAACTCCCAT
>probe:Drosophila_2:1623596_at:512:473; Interrogation_Position=557; Antisense; GTTCACAGCCGATATATGTCTACCA
>probe:Drosophila_2:1623596_at:302:211; Interrogation_Position=619; Antisense; AAGACGCAGGCCCAAGTTCCATCGA
>probe:Drosophila_2:1623596_at:472:721; Interrogation_Position=635; Antisense; TTCCATCGAGGAACTACCTGCCAGT

Paste this into a BLAST search page for me
GATCAGTCAGTATCACCACCAGGATAGCATGGCCAGTACGCCTATGGTTAGTTACATGGCACCACTGTATTCCAAAGACCCGCACCGTGGATGGTGTGATAATGGCGAAACCCAGACCGTGGACTGATGCCGAGGGCTTCCATGTAACCTAGGAAACCCCTGAAGTGGCTGCACTGAACACAGCATCTGGAGGCCCATAAGGTGGCCGCCGCTAAGGTTGCATTCGGTTGCATTCTTCAAGCGTTTCGAATGGTGATACCGAATCCAACTCCCATGTTCACAGCCGATATATGTCTACCAAAGACGCAGGCCCAAGTTCCATCGATTCCATCGAGGAACTACCTGCCAGT

Full Affymetrix probeset data:

Annotations for 1623596_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720